Human AQP11/AQPX1 ORF/cDNA clone-Lentivirus plasmid (NM_173039)

Cat. No.: pGMLP000005
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AQP11/AQPX1 Lentiviral expression plasmid for AQP11 lentivirus packaging, AQP11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to AQP11/AQPX1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $504
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000005
Gene Name AQP11
Accession Number NM_173039
Gene ID 282679
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 816 bp
Gene Alias AQPX1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCGCCGCTGCTGGGGCTCCGGTCCGAGCTGCAGGACACCTGCACCTCGCTGGGACTGATGCTGTCGGTGGTGCTGCTCATGGGGCTGGCCCGCGTAGTCGCCCGGCAGCAGCTGCACAGGCCGGTGGCCCACGCCTTCGTCCTGGAGTTTCTAGCCACCTTCCAGCTCTGCTGCTGCACCCACGAGCTGCAACTGCTGAGCGAACAGCACCCCGCGCACCCCACCTGGACGCTGACGCTCGTCTACTTCTTCTCGCTTGTGCATGGCCTGACTCTGGTGGGCACGTCCAGCAACCCGTGCGGCGTGATGATGCAGATGATGCTGGGGGGCATGTCCCCCGAGACGGGTGCGGTGAGGCTATTGGCTCAGCTGGTTAGTGCCCTGTGCAGCAGGTACTGCACAAGCGCCTTGTGGAGCTTGGGTCTGACCCAGTATCACGTCAGCGAGAGGAGCTTCGCTTGCAAGAATCCCATCCGAGTCGACTTGCTCAAAGCGGTCATCACAGAGGCCGTCTGCTCCTTTCTCTTCCACAGCGCTCTGCTGCACTTCCAGGAAGTCCGAACCAAGCTTCGTATCCACCTGCTGGCTGCACTCATCACCTTTTTGGTCTATGCAGGAGGAAGTCTAACAGGAGCTGTATTTAATCCAGCTTTGGCACTTTCGCTACATTTCATGTGTTTTGATGAAGCATTCCCTCAGTTTTTTATAGTATACTGGCTGGCTCCTTCTTTAGGTATATTGTTGATGATTTTGATGTTCAGCTTTTTCCTTCCATGGCTGCATAACAACCATACAATTAATAAAAAGGAATAA
ORF Protein Sequence MSPLLGLRSELQDTCTSLGLMLSVVLLMGLARVVARQQLHRPVAHAFVLEFLATFQLCCCTHELQLLSEQHPAHPTWTLTLVYFFSLVHGLTLVGTSSNPCGVMMQMMLGGMSPETGAVRLLAQLVSALCSRYCTSALWSLGLTQYHVSERSFACKNPIRVDLLKAVITEAVCSFLFHSALLHFQEVRTKLRIHLLAALITFLVYAGGSLTGAVFNPALALSLHFMCFDEAFPQFFIVYWLAPSLGILLMILMFSFFLPWLHNNHTINKKE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0078-Ab Anti-AQP11/ AQPX1 monoclonal antibody
    Target Antigen GM-Tg-g-MP0078-Ag AQP11 VLP (virus-like particle)
    ORF Viral Vector pGMLP000005 Human AQP11 Lentivirus plasmid
    ORF Viral Vector vGMLP000005 Human AQP11 Lentivirus particle


    Target information

    Target ID GM-MP0078
    Target Name AQP11
    Gene Group Identifier
    （Target Gene ID in Homo species)         		282679
    Gene ID 100063181 (Equus caballus), 101086748 (Felis catus), 282679 (Homo sapiens), 286758 (Rattus norvegicus)
    476798 (Canis lupus familiaris), 510038 (Bos taurus), 66333 (Mus musculus), 698835 (Macaca mulatta)
    Gene Symbols & Synonyms AQP11,Aqp11,AQPX1,sjds,1700015P13Rik
    Target Alternative Names 1700015P13Rik,AQP-11,AQP11,AQPX1,Aqp11,Aquaporin-11,sjds
    Uniprot Accession F6S3G9,Q8BHH1,Q8CHM1,Q8NBQ7
    Additional SwissProt Accessions: F6S3G9,Q8NBQ7,Q8CHM1,Q8BHH1
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000017607, ENSG00000178301, ENSCAFG00845009094, ENSBTAG00000019928, ENSMUSG00000042797, ENSMMUG00000018944
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.