Human CYB561D2/101F6/TSP10 ORF/cDNA clone-Lentivirus plasmid (NM_007022.4)

Cat. No.: pGMLP000013
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CYB561D2/101F6/TSP10 Lentiviral expression plasmid for CYB561D2 lentivirus packaging, CYB561D2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CYB561D2/101F6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $467.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000013
Gene Name CYB561D2
Accession Number NM_007022.4
Gene ID 11068
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 669 bp
Gene Alias 101F6,TSP10,XXcos-LUCA11.4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCCTTTCTGCGGAGACCGAGTCACACATCTACCGAGCTCTGCGTACTGCTTCTGGCGCTGCCGCCCACCTTGTGGCCCTGGGCTTTACCATCTTTGTGGCTGTGCTTGCCAGGCCTGGCTCCAGCCTGTTCTCCTGGCACCCGGTGCTTATGTCTTTGGCTTTCTCCTTCCTGATGACCGAGGCACTACTGGTGTTTTCTCCTGAGAGTTCGCTGCTGCACTCCCTCTCACGGAAAGGCCGAGCACGCTGCCACTGGGTGCTGCAGCTGCTGGCCCTGCTGTGTGCACTGCTGGGCCTCGGCCTTGTCATCCTCCACAAAGAGCAGCTTGGCAAAGCCCACCTGGTTACGCGGCATGGGCAGGCAGGGCTGCTGGCTGTGCTGTGGGCAGGGCTGCAGTGCTCAGGTGGGGTGGGGCTGCTCTACCCCAAGCTGCTGCCCCGATGGCCCCTGGCGAAGCTCAAGCTATACCATGCTACTTCTGGGCTGGTGGGCTACCTGCTGGGTAGTGCCAGCCTCTTGCTGGGCATGTGCTCACTCTGGTTCACTGCCTCTGTCACTGGTGCAGCCTGGTACCTGGCTGTATTATGCCCTGTCCTCACCAGCTTGGTCATTATGAACCAGGTGAGCAATGCCTACCTATACCGCAAGAGGATCCAACCATGA
ORF Protein Sequence MALSAETESHIYRALRTASGAAAHLVALGFTIFVAVLARPGSSLFSWHPVLMSLAFSFLMTEALLVFSPESSLLHSLSRKGRARCHWVLQLLALLCALLGLGLVILHKEQLGKAHLVTRHGQAGLLAVLWAGLQCSGGVGLLYPKLLPRWPLAKLKLYHATSGLVGYLLGSASLLLGMCSLWFTASVTGAAWYLAVLCPVLTSLVIMNQVSNAYLYRKRIQP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0638-Ab Anti-CYB561D2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0638-Ag CYB561D2 protein
    ORF Viral Vector pGMLP000013 Human CYB561D2 Lentivirus plasmid
    ORF Viral Vector vGMLP000013 Human CYB561D2 Lentivirus particle


    Target information

    Target ID GM-IP0638
    Target Name CYB561D2
    Gene Group Identifier
    (Target Gene ID in Homo species)
    11068
    Gene ID 100061714 (Equus caballus), 101095404 (Felis catus), 11068 (Homo sapiens), 363137 (Rattus norvegicus)
    484759 (Canis lupus familiaris), 523966 (Bos taurus), 56368 (Mus musculus), 702280 (Macaca mulatta)
    Gene Symbols & Synonyms CYB561D2,LOC101095404,Cyb561d2,101F6,TSP10,TSCytb,XXcos-LUCA11.4,Tsp10
    Target Alternative Names 101F6,CYB561D2,Cyb561d2,Cytochrome b561 domain-containing protein 2,LOC101095404,Putative tumor suppressor protein 101F6,TSCytb,TSP10,Transmembrane reductase CYB561D2,Tsp10,XXcos-LUCA11.4
    Uniprot Accession O14569,Q5E965,Q641Y1,Q9WUE3
    Additional SwissProt Accessions: O14569,Q641Y1,Q5E965,Q9WUE3
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000021970, ENSG00000114395, ENSCAFG00845021108, ENSBTAG00000019163, ENSMUSG00000037190, ENSMMUG00000007019
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.