Human GEM/KIR ORF/cDNA clone-Lentivirus plasmid (NM_181702)

Cat. No.: pGMLP000125
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GEM/KIR Lentiviral expression plasmid for GEM lentivirus packaging, GEM lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to GEM/KIR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $522.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000125
Gene Name GEM
Accession Number NM_181702
Gene ID 2669
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 891 bp
Gene Alias KIR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACTCTGAATAATGTCACCATGCGCCAGGGCACTGTGGGCATGCAGCCACAGCAGCAGCGCTGGAGCATCCCAGCTGATGGCAGGCATCTGATGGTCCAGAAAGAGCCCCACCAGTACAGCCACCGCAACCGCCATTCTGCTACCCCTGAGGACCACTGCCGCCGAAGCTGGTCCTCTGACTCCACAGACTCAGTCATCTCCTCTGAGTCAGGGAACACCTACTACCGAGTGGTGCTCATAGGGGAGCAGGGGGTGGGCAAGTCCACTCTGGCCAACATCTTTGCAGGTGTGCATGACAGCATGGACAGCGACTGCGAGGTGCTGGGAGAAGATACATATGAACGAACCCTGATGGTTGATGGGGAAAGTGCAACGATTATACTCCTGGATATGTGGGAAAATAAGGGGGAAAATGAATGGCTCCATGACCACTGCATGCAGGTCGGGGACGCATACCTGATTGTCTACTCAATCACAGACCGAGCGAGCTTCGAGAAGGCATCTGAGCTGCGAATCCAGCTCCGCAGGGCCCGGCAGACAGAGGACATTCCCATAATTTTGGTTGGCAACAAAAGTGACTTAGTGCGGTGCCGAGAAGTGTCTGTATCAGAAGGGAGAGCCTGTGCAGTGGTGTTTGACTGCAAGTTCATCGAGACCTCTGCAGCTGTCCAGCACAACGTGAAGGAGCTGTTTGAGGGCATTGTGCGACAGGTGCGCCTTCGGCGGGACAGCAAGGAGAAGAATGAACGGCGGCTGGCCTACCAGAAAAGGAAGGAGAGCATGCCCAGGAAAGCCAGGCGCTTCTGGGGCAAGATCGTGGCCAAAAACAACAAGAATATGGCCTTCAAGCTCAAGTCCAAATCCTGCCATGACCTCTCTGTACTCTAG
ORF Protein Sequence MTLNNVTMRQGTVGMQPQQQRWSIPADGRHLMVQKEPHQYSHRNRHSATPEDHCRRSWSSDSTDSVISSESGNTYYRVVLIGEQGVGKSTLANIFAGVHDSMDSDCEVLGEDTYERTLMVDGESATIILLDMWENKGENEWLHDHCMQVGDAYLIVYSITDRASFEKASELRIQLRRARQTEDIPIILVGNKSDLVRCREVSVSEGRACAVVFDCKFIETSAAVQHNVKELFEGIVRQVRLRRDSKEKNERRLAYQKRKESMPRKARRFWGKIVAKNNKNMAFKLKSKSCHDLSVL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T35063-Ab Anti-GEM monoclonal antibody
    Target Antigen GM-Tg-g-T35063-Ag GEM protein
    ORF Viral Vector pGMLP000125 Human GEM Lentivirus plasmid
    ORF Viral Vector vGMLP000125 Human GEM Lentivirus particle


    Target information

    Target ID GM-T35063
    Target Name GEM
    Gene Group Identifier
    （Target Gene ID in Homo species)         		2669
    Gene ID 100050475 (Equus caballus), 101083484 (Felis catus), 14579 (Mus musculus), 2669 (Homo sapiens)
    297902 (Rattus norvegicus), 538437 (Bos taurus), 611634 (Canis lupus familiaris), 699130 (Macaca mulatta)
    Gene Symbols & Synonyms GEM,Gem,KIR
    Target Alternative Names GEM,GTP-binding mitogen-induced T-cell protein,GTP-binding protein GEM,Gem,KIR,RAS-like protein KIR
    Uniprot Accession P55040,P55041
    Additional SwissProt Accessions: P55041,P55040
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Prostate Cancer
    Disease from KEGG
    Gene Ensembl ENSECAG00000018531, ENSMUSG00000028214, ENSG00000164949, ENSBTAG00000007596, ENSCAFG00845014817, ENSMMUG00000062934
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.