Human CLDN3/C7orf1/CPE-R2 ORF/cDNA clone-Lentivirus plasmid (NM_001306.3)

Cat. No.: pGMLP000200
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CLDN3/C7orf1/CPE-R2 Lentiviral expression plasmid for CLDN3 lentivirus packaging, CLDN3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to Claudin 3/CLDN3/CLDN3/C7orf1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $465.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000200
Gene Name CLDN3
Accession Number NM_001306.3
Gene ID 1365
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 663 bp
Gene Alias C7orf1,CPE-R2,CPETR2,HRVP1,RVP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCATGGGCCTGGAGATCACGGGCACCGCGCTGGCCGTGCTGGGCTGGCTGGGCACCATCGTGTGCTGCGCGTTGCCCATGTGGCGCGTGTCGGCCTTCATCGGCAGCAACATCATCACGTCGCAGAACATCTGGGAGGGCCTGTGGATGAACTGCGTGGTGCAGAGCACCGGCCAGATGCAGTGCAAGGTGTACGACTCGCTGCTGGCACTGCCACAGGACCTTCAGGCGGCCCGCGCCCTCATCGTGGTGGCCATCCTGCTGGCCGCCTTCGGGCTGCTAGTGGCGCTGGTGGGCGCCCAGTGCACCAACTGCGTGCAGGACGACACGGCCAAGGCCAAGATCACCATCGTGGCAGGCGTGCTGTTCCTTCTCGCCGCCCTGCTCACCCTCGTGCCGGTGTCCTGGTCGGCCAACACCATTATCCGGGACTTCTACAACCCCGTGGTGCCCGAGGCGCAGAAGCGCGAGATGGGCGCGGGCCTGTACGTGGGCTGGGCGGCCGCGGCGCTGCAGCTGCTGGGGGGCGCGCTGCTCTGCTGCTCGTGTCCCCCACGCGAGAAGAAGTACACGGCCACCAAGGTCGTCTACTCCGCGCCGCGCTCCACCGGCCCGGGAGCCAGCCTGGGCACAGGCTACGACCGCAAGGACTACGTCTAA
ORF Protein Sequence MSMGLEITGTALAVLGWLGTIVCCALPMWRVSAFIGSNIITSQNIWEGLWMNCVVQSTGQMQCKVYDSLLALPQDLQAARALIVVAILLAAFGLLVALVGAQCTNCVQDDTAKAKITIVAGVLFLLAALLTLVPVSWSANTIIRDFYNPVVPEAQKREMGAGLYVGWAAAALQLLGGALLCCSCPPREKKYTATKVVYSAPRSTGPGASLGTGYDRKDYV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IO024-Ab Anti-CLD3/ CLDN3/ C7orf1 monoclonal antibody
    Target Antigen GM-Tg-g-IO024-Ag CLDN3 VLP (virus-like particle)
    ORF Viral Vector pGMLP000200 Human CLDN3 Lentivirus plasmid
    ORF Viral Vector vGMLP000200 Human CLDN3 Lentivirus particle


    Target information

    Target ID GM-IO024
    Target Name Claudin 3/CLDN3
    Gene Group Identifier
    （Target Gene ID in Homo species)         		1365
    Gene ID 100059922 (Equus caballus), 105261291 (Felis catus), 12739 (Mus musculus), 1365 (Homo sapiens)
    403648 (Canis lupus familiaris), 404153 (Bos taurus), 65130 (Rattus norvegicus), 716771 (Macaca mulatta)
    Gene Symbols & Synonyms CLDN3,Cldn3,mRVP1,Cpetr2,RVP1,HRVP1,C7orf1,CPE-R2,CPETR2,Claudin-3,claudin-3
    Target Alternative Names C7orf1,CLDN3,CPE-R2,CPE-receptor 2),CPETR2,Claudin 3,Claudin-3,Cldn3,Clostridium perfringens enterotoxin receptor 2 (CPE-R 2,Cpetr2,HRVP1,RVP1,Rat ventral prostate.1 protein homolog (hRVP1),claudin-3,mRVP1
    Uniprot Accession O15551,Q63400,Q765N9,Q95KM5,Q9Z0G9
    Additional SwissProt Accessions: Q9Z0G9,O15551,Q95KM5,Q765N9,Q63400
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease cancer, Perinatal necrotizing enterocolitis, ovarian cancer
    Disease from KEGG Cell adhesion molecules, Tight junction, Leukocyte transendothelial migration, Pathogenic Escherichia coli infection, Hepatitis C
    Gene Ensembl ENSECAG00000057944, ENSMUSG00000070473, ENSG00000165215, ENSCAFG00845003145, ENSBTAG00000040432, ENSMMUG00000001143
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.