Human CLDN3/C7orf1/CPE-R2 ORF/cDNA clone-Lentivirus plasmid (NM_001306.3)
Cat. No.: pGMLP000200
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CLDN3/C7orf1/CPE-R2 Lentiviral expression plasmid for CLDN3 lentivirus packaging, CLDN3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
Claudin 3/CLDN3/CLDN3/C7orf1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLP000200 |
| Gene Name | CLDN3 |
| Accession Number | NM_001306.3 |
| Gene ID | 1365 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 663 bp |
| Gene Alias | C7orf1,CPE-R2,CPETR2,HRVP1,RVP1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGTCCATGGGCCTGGAGATCACGGGCACCGCGCTGGCCGTGCTGGGCTGGCTGGGCACCATCGTGTGCTGCGCGTTGCCCATGTGGCGCGTGTCGGCCTTCATCGGCAGCAACATCATCACGTCGCAGAACATCTGGGAGGGCCTGTGGATGAACTGCGTGGTGCAGAGCACCGGCCAGATGCAGTGCAAGGTGTACGACTCGCTGCTGGCACTGCCACAGGACCTTCAGGCGGCCCGCGCCCTCATCGTGGTGGCCATCCTGCTGGCCGCCTTCGGGCTGCTAGTGGCGCTGGTGGGCGCCCAGTGCACCAACTGCGTGCAGGACGACACGGCCAAGGCCAAGATCACCATCGTGGCAGGCGTGCTGTTCCTTCTCGCCGCCCTGCTCACCCTCGTGCCGGTGTCCTGGTCGGCCAACACCATTATCCGGGACTTCTACAACCCCGTGGTGCCCGAGGCGCAGAAGCGCGAGATGGGCGCGGGCCTGTACGTGGGCTGGGCGGCCGCGGCGCTGCAGCTGCTGGGGGGCGCGCTGCTCTGCTGCTCGTGTCCCCCACGCGAGAAGAAGTACACGGCCACCAAGGTCGTCTACTCCGCGCCGCGCTCCACCGGCCCGGGAGCCAGCCTGGGCACAGGCTACGACCGCAAGGACTACGTCTAA |
| ORF Protein Sequence | MSMGLEITGTALAVLGWLGTIVCCALPMWRVSAFIGSNIITSQNIWEGLWMNCVVQSTGQMQCKVYDSLLALPQDLQAARALIVVAILLAAFGLLVALVGAQCTNCVQDDTAKAKITIVAGVLFLLAALLTLVPVSWSANTIIRDFYNPVVPEAQKREMGAGLYVGWAAAALQLLGGALLCCSCPPREKKYTATKVVYSAPRSTGPGASLGTGYDRKDYV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IO024-Ab | Anti-CLD3/ CLDN3/ C7orf1 monoclonal antibody |
| Target Antigen | GM-Tg-g-IO024-Ag | CLDN3 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP000200 | Human CLDN3 Lentivirus plasmid |
| ORF Viral Vector | vGMLP000200 | Human CLDN3 Lentivirus particle |
Target information
| Target ID | GM-IO024 |
| Target Name | Claudin 3/CLDN3 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
1365 |
| Gene ID |
100059922 (Equus caballus), 105261291 (Felis catus), 12739 (Mus musculus), 1365 (Homo sapiens) 403648 (Canis lupus familiaris), 404153 (Bos taurus), 65130 (Rattus norvegicus), 716771 (Macaca mulatta) |
| Gene Symbols & Synonyms | CLDN3,Cldn3,mRVP1,Cpetr2,RVP1,HRVP1,C7orf1,CPE-R2,CPETR2,Claudin-3,claudin-3 |
| Target Alternative Names | C7orf1,CLDN3,CPE-R2,CPE-receptor 2),CPETR2,Claudin 3,Claudin-3,Cldn3,Clostridium perfringens enterotoxin receptor 2 (CPE-R 2,Cpetr2,HRVP1,RVP1,Rat ventral prostate.1 protein homolog (hRVP1),claudin-3,mRVP1 |
| Uniprot Accession |
O15551,Q63400,Q765N9,Q95KM5,Q9Z0G9
Additional SwissProt Accessions: Q9Z0G9,O15551,Q95KM5,Q765N9,Q63400 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target |
| Disease | cancer, Perinatal necrotizing enterocolitis, ovarian cancer |
| Disease from KEGG | Cell adhesion molecules, Tight junction, Leukocyte transendothelial migration, Pathogenic Escherichia coli infection, Hepatitis C |
| Gene Ensembl | ENSECAG00000057944, ENSMUSG00000070473, ENSG00000165215, ENSCAFG00845003145, ENSBTAG00000040432, ENSMMUG00000001143 |
| Target Classification | Checkpoint-Immuno Oncology |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


