Human STAR/STARD1 ORF/cDNA clone-Lentivirus plasmid (NM_000349)

Cat. No.: pGMLP000227
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human STAR/STARD1 Lentiviral expression plasmid for STAR lentivirus packaging, STAR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to STAR/STARD1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $514.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000227
Gene Name STAR
Accession Number NM_000349
Gene ID 6770
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 858 bp
Gene Alias STARD1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCTAGCGACATTCAAGCTGTGCGCTGGGAGCTCCTACAGACACATGCGCAACATGAAGGGGCTGAGGCAACAGGCTGTGATGGCCATCAGCCAGGAGCTGAACCGGAGGGCCCTGGGGGGCCCCACCCCTAGCACGTGGATTAACCAGGTTCGGCGGCGGAGCTCTCTACTCGGTTCTCGGCTGGAAGAGACTCTCTACAGTGACCAGGAGCTGGCCTATCTCCAGCAGGGGGAGGAGGCCATGCAGAAGGCCTTGGGCATCCTTAGCAACCAAGAGGGCTGGAAGAAGGAGAGTCAGCAGGACAATGGGGACAAAGTGATGAGTAAAGTGGTCCCAGATGTGGGCAAGGTGTTCCGGCTGGAGGTCGTGGTGGACCAGCCCATGGAGAGGCTCTATGAAGAGCTCGTGGAGCGCATGGAAGCAATGGGGGAGTGGAACCCCAATGTCAAGGAGATCAAGGTCCTGCAGAAGATCGGAAAAGATACATTCATTACTCACGAGCTGGCTGCCGAGGCAGCAGGAAACCTGGTGGGGCCCCGTGACTTTGTGAGCGTGCGCTGTGCCAAGCGCCGAGGCTCCACCTGTGTGCTGGCTGGCATGGCCACAGACTTCGGGAACATGCCTGAGCAGAAGGGTGTCATCAGGGCGGAGCACGGTCCCACTTGCATGGTGCTTCACCCGTTGGCTGGAAGTCCCTCTAAGACCAAACTTACGTGGCTACTCAGCATCGACCTCAAGGGGTGGCTGCCCAAGAGCATCATCAACCAGGTCCTGTCCCAGACCCAGGTGGATTTTGCCAACCACCTGCGCAAGCGCCTGGAGTCCCACCCTGCCTCTGAAGCCAGGTGTTGA
ORF Protein Sequence MLLATFKLCAGSSYRHMRNMKGLRQQAVMAISQELNRRALGGPTPSTWINQVRRRSSLLGSRLEETLYSDQELAYLQQGEEAMQKALGILSNQEGWKKESQQDNGDKVMSKVVPDVGKVFRLEVVVDQPMERLYEELVERMEAMGEWNPNVKEIKVLQKIGKDTFITHELAAEAAGNLVGPRDFVSVRCAKRRGSTCVLAGMATDFGNMPEQKGVIRAEHGPTCMVLHPLAGSPSKTKLTWLLSIDLKGWLPKSIINQVLSQTQVDFANHLRKRLESHPASEARC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T33063-Ab Anti-STAR monoclonal antibody
    Target Antigen GM-Tg-g-T33063-Ag STAR protein
    ORF Viral Vector pGMLP000227 Human STAR Lentivirus plasmid
    ORF Viral Vector vGMLP000227 Human STAR Lentivirus particle


    Target information

    Target ID GM-T33063
    Target Name STAR
    Gene Group Identifier
    （Target Gene ID in Homo species)         		6770
    Gene ID 100009707 (Equus caballus), 100616071 (Felis catus), 20845 (Mus musculus), 25557 (Rattus norvegicus)
    281507 (Bos taurus), 475588 (Canis lupus familiaris), 6770 (Homo sapiens), 699515 (Macaca mulatta)
    Gene Symbols & Synonyms STAR,Star,stARD1,D8Ertd419e,STARD1
    Target Alternative Names D8Ertd419e,STAR,STARD1,START domain-containing protein 1 (StARD1),StAR,Star,Steroidogenic acute regulatory protein,mitochondrial,stARD1
    Uniprot Accession O46689,P49675,P51557,P97826,Q28918
    Additional SwissProt Accessions: O46689,P51557,P97826,Q28918,P49675
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG Ovarian steroidogenesis, Aldosterone synthesis and secretion, Cortisol synthesis and secretion, Cushing syndrome, Cholesterol metabolism
    Gene Ensembl ENSMUSG00000031574, ENSBTAG00000033345, ENSCAFG00845013206, ENSG00000147465, ENSMMUG00000013676
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.