Human MLANA/MART-1/MART1 ORF/cDNA clone-Lentivirus plasmid (NM_005511)

Cat. No.: pGMLP000325
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MLANA/MART-1/MART1 Lentiviral expression plasmid for MLANA lentivirus packaging, MLANA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to Melan-A/MLANA/MLANA/MART-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000325
Gene Name MLANA
Accession Number NM_005511
Gene ID 2315
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 357 bp
Gene Alias MART-1,MART1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCAAGAGAAGATGCTCACTTCATCTATGGTTACCCCAAGAAGGGGCACGGCCACTCTTACACCACGGCTGAAGAGGCCGCTGGGATCGGCATCCTGACAGTGATCCTGGGAGTCTTACTGCTCATCGGCTGTTGGTATTGTAGAAGACGAAATGGATACAGAGCCTTGATGGATAAAAGTCTTCATGTTGGCACTCAATGTGCCTTAACAAGAAGATGCCCACAAGAAGGGTTTGATCATCGGGACAGCAAAGTGTCTCTTCAAGAGAAAAACTGTGAACCTGTGGTTCCCAATGCTCCACCTGCTTATGAGAAACTCTCTGCAGAACAGTCACCACCACCTTATTCACCTTAA
ORF Protein Sequence MPREDAHFIYGYPKKGHGHSYTTAEEAAGIGILTVILGVLLLIGCWYCRRRNGYRALMDKSLHVGTQCALTRRCPQEGFDHRDSKVSLQEKNCEPVVPNAPPAYEKLSAEQSPPPYSP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0079-Ab Anti-MLANA monoclonal antibody
    Target Antigen GM-Tg-g-IP0079-Ag MLANA protein
    ORF Viral Vector pGMLP000325 Human MLANA Lentivirus plasmid
    ORF Viral Vector vGMLP000325 Human MLANA Lentivirus particle


    Target information

    Target ID GM-IP0079
    Target Name Melan-A/MLANA
    Gene Group Identifier
    （Target Gene ID in Homo species)         		2315
    Gene ID 100051824 (Equus caballus), 101092899 (Felis catus), 2315 (Homo sapiens), 293890 (Rattus norvegicus)
    403495 (Canis lupus familiaris), 616945 (Bos taurus), 715882 (Macaca mulatta), 77836 (Mus musculus)
    Gene Symbols & Synonyms MLANA,Mlana,MART1,MART-1,Mart1,A930034P04Rik
    Target Alternative Names A930034P04Rik,Antigen LB39-AA,Antigen SK29-AA,MART-1,MART1,MLANA,Mart1,Melan-A,Melanoma antigen recognized by T-cells 1,Mlana,Protein Melan-A
    Uniprot Accession Q16655
    Additional SwissProt Accessions: Q16655
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSECAG00000009103, ENSG00000120215, ENSCAFG00845023621, ENSBTAG00000007440, ENSMMUG00000056663, ENSMUSG00000024806
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.