Human UBE2B/E2-17kDa/HHR6B ORF/cDNA clone-Lentivirus plasmid (NM_003337)

Cat. No.: pGMLP000343
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human UBE2B/E2-17kDa/HHR6B Lentiviral expression plasmid for UBE2B lentivirus packaging, UBE2B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to UBE2B/E2-17kDa products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000343
Gene Name UBE2B
Accession Number NM_003337
Gene ID 7320
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 459 bp
Gene Alias E2-17kDa,HHR6B,HR6B,RAD6B,UBC2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCGACCCCGGCCCGGAGGAGGCTCATGCGGGATTTCAAGCGGTTACAAGAGGACCCACCTGTGGGTGTCAGTGGCGCACCATCTGAAAACAACATCATGCAGTGGAATGCAGTTATATTTGGACCAGAAGGGACACCTTTTGAAGATGGTACTTTTAAACTAGTAATAGAATTTTCTGAAGAATATCCAAATAAACCACCAACTGTTAGGTTTTTATCCAAAATGTTTCATCCAAATGTGTATGCTGATGGTAGCATATGTTTAGATATCCTTCAGAATCGATGGAGTCCAACATATGATGTATCTTCTATCTTAACATCAATTCAGTCTCTGCTGGATGAACCGAATCCTAACAGTCCAGCCAATAGCCAGGCAGCACAGCTTTATCAGGAAAACAAACGAGAATATGAGAAAAGAGTTTCGGCCATTGTTGAACAAAGCTGGAATGATTCATAA
ORF Protein Sequence MSTPARRRLMRDFKRLQEDPPVGVSGAPSENNIMQWNAVIFGPEGTPFEDGTFKLVIEFSEEYPNKPPTVRFLSKMFHPNVYADGSICLDILQNRWSPTYDVSSILTSIQSLLDEPNPNSPANSQAAQLYQENKREYEKRVSAIVEQSWNDS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2371-Ab Anti-UBE2B/ E2-17kDa/ HHR6B monoclonal antibody
    Target Antigen GM-Tg-g-MP2371-Ag UBE2B VLP (virus-like particle)
    ORF Viral Vector pGMLP000343 Human UBE2B Lentivirus plasmid
    ORF Viral Vector vGMLP000343 Human UBE2B Lentivirus particle


    Target information

    Target ID GM-MP2371
    Target Name UBE2B
    Gene Group Identifier
    （Target Gene ID in Homo species)         		7320
    Gene ID 100062920 (Equus caballus), 101099525 (Felis catus), 22210 (Mus musculus), 474683 (Canis lupus familiaris)
    512207 (Bos taurus), 710678 (Macaca mulatta), 7320 (Homo sapiens), 81816 (Rattus norvegicus)
    Gene Symbols & Synonyms UBE2B,Ube2b,HR6B,E214K,Rad6b,mHR6B,E2-14k,UBC2,HHR6B,RAD6B,E2-17kDa
    Target Alternative Names E2 ubiquitin-conjugating enzyme B,E2-14k,E2-17kDa,E214K,HHR6B,HR6B,RAD6 homolog B (HR6B,RAD6B,Rad6b,UBC2,UBE2B,Ube2b,Ubiquitin carrier protein B,Ubiquitin-conjugating enzyme E2 B,Ubiquitin-conjugating enzyme E2-17 kDa,Ubiquitin-protein ligase B,hHR6B),mHR6B
    Uniprot Accession P63146,P63147,P63149,Q32P99
    Additional SwissProt Accessions: P63147,Q32P99,P63146,P63149
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000032089, ENSMUSG00000020390, ENSCAFG00845012898, ENSBTAG00000010982, ENSMMUG00000016641, ENSG00000119048
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.