Human CD69/AIM/BL-AC/P26 ORF/cDNA clone-Lentivirus plasmid (NM_001781)

Cat. No.: pGMLP000408
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD69/AIM/BL-AC/P26 Lentiviral expression plasmid for CD69 lentivirus packaging, CD69 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CD69/AIM products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000408
Gene Name CD69
Accession Number NM_001781
Gene ID 969
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 600 bp
Gene Alias AIM,BL-AC/P26,CLEC2C,EA1,GP32/28,MLR-3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCTCTGAAAATTGTTTCGTAGCAGAGAACAGCTCTTTGCATCCGGAGAGTGGACAAGAAAATGATGCCACCAGTCCCCATTTCTCAACACGTCATGAAGGGTCCTTCCAAGTTCCTGTCCTGTGTGCTGTAATGAATGTGGTCTTCATCACCATTTTAATCATAGCTCTCATTGCCTTATCAGTGGGCCAATACAATTGTCCAGGCCAATACACATTCTCAATGCCATCAGACAGCCATGTTTCTTCATGCTCTGAGGACTGGGTTGGCTACCAGAGGAAATGCTACTTTATTTCTACTGTGAAGAGGAGCTGGACTTCAGCCCAAAATGCTTGTTCTGAACATGGTGCTACTCTTGCTGTCATTGATTCTGAAAAGGACATGAACTTTCTAAAACGATACGCAGGTAGAGAGGAACACTGGGTTGGACTGAAAAAGGAACCTGGTCACCCATGGAAGTGGTCAAATGGCAAAGAATTTAACAACTGGTTCAACGTTACAGGGTCTGACAAGTGTGTTTTTCTGAAAAACACAGAGGTCAGCAGCATGGAATGTGAGAAGAATTTATACTGGATATGTAACAAACCTTACAAATAA
ORF Protein Sequence MSSENCFVAENSSLHPESGQENDATSPHFSTRHEGSFQVPVLCAVMNVVFITILIIALIALSVGQYNCPGQYTFSMPSDSHVSSCSEDWVGYQRKCYFISTVKRSWTSAQNACSEHGATLAVIDSEKDMNFLKRYAGREEHWVGLKKEPGHPWKWSNGKEFNNWFNVTGSDKCVFLKNTEVSSMECEKNLYWICNKPYK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0188-Ab Anti-CD69 monoclonal antibody
    Target Antigen GM-Tg-g-IP0188-Ag CD69 protein
    ORF Viral Vector pGMLP000408 Human CD69 Lentivirus plasmid
    ORF Viral Vector pGMAP000449 Human CD69 Adenovirus plasmid
    ORF Viral Vector vGMLP000408 Human CD69 Lentivirus particle
    ORF Viral Vector vGMAP000449 Human CD69 Adenovirus particle


    Target information

    Target ID GM-IP0188
    Target Name CD69
    Gene Group Identifier
    (Target Gene ID in Homo species)
    969
    Gene ID 100053615 (Equus caballus), 101082498 (Felis catus), 281058 (Bos taurus), 29187 (Rattus norvegicus)
    477698 (Canis lupus familiaris), 717288 (Macaca mulatta), 969 (Homo sapiens)
    Gene Symbols & Synonyms CD69,Cd69,AIM,EA1,MLR-3,CLEC2C,GP32/28,BL-AC/P26
    Target Alternative Names AIM,Activation inducer molecule (AIM),BL-AC/P26,C-type lectin domain family 2 member C,CD69,CLEC2C,Cd69,EA1,Early T-cell activation antigen p60,Early activation antigen CD69,GP32/28,Leukocyte surface antigen Leu-23,MLR-3
    Uniprot Accession Q07108
    Additional SwissProt Accessions: Q07108
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSECAG00000023027, ENSBTAG00000002135, ENSCAFG00845027879, ENSMMUG00000015297, ENSG00000110848
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.