Human DDIT4/Dig2/REDD-1 ORF/cDNA clone-Lentivirus plasmid (NM_019058)

Cat. No.: pGMLP000413
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DDIT4/Dig2/REDD-1 Lentiviral expression plasmid for DDIT4 lentivirus packaging, DDIT4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to REDD1/DDIT4/DDIT4/Dig2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $474.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000413
Gene Name DDIT4
Accession Number NM_019058
Gene ID 54541
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 699 bp
Gene Alias Dig2,REDD-1,REDD1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCTAGCCTTTGGGACCGCTTCTCGTCGTCGTCCACCTCCTCTTCGCCCTCGTCCTTGCCCCGAACTCCCACCCCAGATCGGCCGCCGCGCTCAGCCTGGGGGTCGGCGACCCGGGAGGAGGGGTTTGACCGCTCCACGAGCCTGGAGAGCTCGGACTGCGAGTCCCTGGACAGCAGCAACAGTGGCTTCGGGCCGGAGGAAGACACGGCTTACCTGGATGGGGTGTCGTTGCCCGACTTCGAGCTGCTCAGTGACCCTGAGGATGAACACTTGTGTGCCAACCTGATGCAGCTGCTGCAGGAGAGCCTGGCCCAGGCGCGGCTGGGCTCTCGACGCCCTGCGCGCCTGCTGATGCCTAGCCAGTTGGTAAGCCAGGTGGGCAAAGAACTACTGCGCCTGGCCTACAGCGAGCCGTGCGGCCTGCGGGGGGCGCTGCTGGACGTCTGCGTGGAGCAGGGCAAGAGCTGCCACAGCGTGGGCCAGCTGGCACTCGACCCCAGCCTGGTGCCCACCTTCCAGCTGACCCTCGTGCTGCGCCTGGACTCACGACTCTGGCCCAAGATCCAGGGGCTGTTTAGCTCCGCCAACTCTCCCTTCCTCCCTGGCTTCAGCCAGTCCCTGACGCTGAGCACTGGCTTCCGAGTCATCAAGAAGAAGCTGTACAGCTCGGAACAGCTGCTCATTGAGGAGTGTTGA
ORF Protein Sequence MPSLWDRFSSSSTSSSPSSLPRTPTPDRPPRSAWGSATREEGFDRSTSLESSDCESLDSSNSGFGPEEDTAYLDGVSLPDFELLSDPEDEHLCANLMQLLQESLAQARLGSRRPARLLMPSQLVSQVGKELLRLAYSEPCGLRGALLDVCVEQGKSCHSVGQLALDPSLVPTFQLTLVLRLDSRLWPKIQGLFSSANSPFLPGFSQSLTLSTGFRVIKKKLYSSEQLLIEEC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T83561-Ab Anti-DDIT4 monoclonal antibody
    Target Antigen GM-Tg-g-T83561-Ag DDIT4 protein
    ORF Viral Vector pGMLP000413 Human DDIT4 Lentivirus plasmid
    ORF Viral Vector pGMPC001505 Human DDIT4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000413 Human DDIT4 Lentivirus particle


    Target information

    Target ID GM-T83561
    Target Name REDD1/DDIT4
    Gene Group Identifier
    （Target Gene ID in Homo species)         		54541
    Gene ID 100072811 (Equus caballus), 101082094 (Felis catus), 140942 (Rattus norvegicus), 489038 (Canis lupus familiaris)
    529235 (Bos taurus), 54541 (Homo sapiens), 715307 (Macaca mulatta), 74747 (Mus musculus)
    Gene Symbols & Synonyms DDIT4,Ddit4,Rtp801,Dig2,REDD1,REDD-1,dig2,5830413E08Rik
    Target Alternative Names 5830413E08Rik,DDIT4,DNA damage-inducible transcript 4 protein,Ddit4,Dig2,HIF-1 responsive protein RTP801,Protein regulated in development and DNA damage response 1 (REDD-1),REDD-1,REDD1,Rtp801,dig2
    Uniprot Accession Q08E62,Q8VHZ9,Q9D3F7,Q9NX09
    Additional SwissProt Accessions: Q8VHZ9,Q08E62,Q9NX09,Q9D3F7
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG PI3K-Akt signaling pathway
    Gene Ensembl ENSECAG00000004107, ENSCAFG00845005617, ENSBTAG00000000163, ENSG00000168209, ENSMMUG00000055226, ENSMUSG00000020108
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.