Human DRICH1/C22orf43/KB-208E9.1 ORF/cDNA clone-Lentivirus plasmid (NM_016449.3)

Cat. No.: pGMLP000030
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DRICH1/C22orf43/KB-208E9.1 Lentiviral expression plasmid for DRICH1 lentivirus packaging, DRICH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to DRICH1/C22orf43 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $472.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000030
Gene Name DRICH1
Accession Number NM_016449.3
Gene ID 51233
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 690 bp
Gene Alias C22orf43,KB-208E9.1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGAATATACTGACCTGTTGTATCAACTCCCACTGTGGCTGGCCCAGGGGGAAGGACGCACCCTGTTATGAATCTGATACTGATATTTATGAGACTGTGGCTGCTGCAACATCAGAATCCACTACTGTAGAGCCTGGCAAGCTGGATGTGGGAGCCACGGAGGGCCAAGACCTGCAGCACATCAGCAACCAAAAGATGCCCACAGGTCCCCCTGAGGACCGCCTGAGTTTAAAATTTCTGCCATCAAGTGAGGAAGACAATGATGATGCCAAGATTTTACCATCACCTGTCCAGGGTTCTTCTGAGGACAACCTGAGTTTAGTATGCCTACCACGAAGTGAAGATGATGACTGTGATGATGATGATGATGATGATGCCCAGATTTTACCGTCACGTGTCCAGGGTGGCTGTTACCGGTTTGATAGCAGTTCTTGTTCTTCTGAGGACAACCTGAGTTTAGTATGCCTACCACGAAGTGAAGATGATGACTGTGATGATGATGATGATGATGCCCAGATTTTACCGTCACCTGTCCAGGCTTGTTCTGAAGATAGCCTGTTTTTAAGATGCTCACTGAGACACAAAGATGAAGAAGAAGAAGATGATGATGACATCCACATAACAGCTCGGATAGAAAGTGACTTGACGCTGGAGAGTCTAAGTGATGAAGAGATTCATCCAGGGTGA
ORF Protein Sequence MGNILTCCINSHCGWPRGKDAPCYESDTDIYETVAAATSESTTVEPGKLDVGATEGQDLQHISNQKMPTGPPEDRLSLKFLPSSEEDNDDAKILPSPVQGSSEDNLSLVCLPRSEDDDCDDDDDDDAQILPSRVQGGCYRFDSSSCSSEDNLSLVCLPRSEDDDCDDDDDDAQILPSPVQACSEDSLFLRCSLRHKDEEEEDDDDIHITARIESDLTLESLSDEEIHPG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0468-Ab Anti-DRICH1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0468-Ag DRICH1 protein
    ORF Viral Vector pGMLP000030 Human DRICH1 Lentivirus plasmid
    ORF Viral Vector vGMLP000030 Human DRICH1 Lentivirus particle


    Target information

    Target ID GM-IP0468
    Target Name DRICH1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    51233
    Gene ID 51233 (Homo sapiens)
    Gene Symbols & Synonyms DRICH1,C22orf43,KB-208E9.1
    Target Alternative Names Aspartate-rich protein 1,C22orf43,DRICH1,KB-208E9.1
    Uniprot Accession Q6PGQ1
    Additional SwissProt Accessions: Q6PGQ1
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSG00000189269
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.