Human MRAP/B27/C21orf61 ORF/cDNA clone-Lentivirus plasmid (BC062721)
Cat. No.: pGMLP000034
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human MRAP/B27/C21orf61 Lentiviral expression plasmid for MRAP lentivirus packaging, MRAP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
MRAP/B27 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLP000034 |
| Gene Name | MRAP |
| Accession Number | BC062721 |
| Gene ID | 56246 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 519 bp |
| Gene Alias | B27,C21orf61,FALP |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCAACGGGACCAACGCCTCTGCCCCATACTACAGCTATGAATACTACCTGGACTATCTGGACCTCATTCCCGTGGACGAGAAGAAGCTGAAAGCCCACAAACATTCCATCGTGATCGCATTCTGGGTTAGCCTGGCTGCCTTCGTGGTGCTGCTCTTCCTCATCTTGCTCTACATGTCCTGGTCCGCCTCCCCGCAGATGAGGAACAGCCCCAAGCACCACCAAACATGCCCCTGGAGTCACGGCCTCAACCTCCACCTCTGCATCCAGAAGTGCCTGCCGTGCCACAGGGAACCCCTGGCAACCTCACAGGCTCAGGCGAGCTCAGTGGAGCCAGGGAGCAGAACTGGCCCTGACCAGCCGCTACGACAGGAGAGCTCCTCCACGTTGCCCCTCGGGGGTTTCCAGACCCACCCCACTCTCCTCTGGGAACTGACCCTCAATGGGGGTCCCCTCGTCAGGAGCAAGCCCAGCGAGCCTCCCCCTGGAGACAGGACCTCTCAATTGCAGAGCTGA |
| ORF Protein Sequence | MANGTNASAPYYSYEYYLDYLDLIPVDEKKLKAHKHSIVIAFWVSLAAFVVLLFLILLYMSWSASPQMRNSPKHHQTCPWSHGLNLHLCIQKCLPCHREPLATSQAQASSVEPGSRTGPDQPLRQESSSTLPLGGFQTHPTLLWELTLNGGPLVRSKPSEPPPGDRTSQLQS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0828-Ab | Anti-MRAP/ B27/ C21orf61 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0828-Ag | MRAP VLP (virus-like particle) |
| ORF Viral Vector | pGMLP000034 | Human MRAP Lentivirus plasmid |
| ORF Viral Vector | pGMAP000279 | Human MRAP Adenovirus plasmid |
| ORF Viral Vector | vGMLP000034 | Human MRAP Lentivirus particle |
| ORF Viral Vector | vGMAP000279 | Human MRAP Adenovirus particle |
Target information
| Target ID | GM-MP0828 |
| Target Name | MRAP |
|
Gene Group Identifier (Target Gene ID in Homo species) |
56246 |
| Gene ID |
100063927 (Equus caballus), 101093795 (Felis catus), 288271 (Rattus norvegicus), 505743 (Bos taurus) 56246 (Homo sapiens), 609708 (Canis lupus familiaris), 701330 (Macaca mulatta), 77037 (Mus musculus) |
| Gene Symbols & Synonyms | MRAP,Mrap,RGD1310648,B27,FALP,FGD2,GCCD2,MRAP1,C21orf61,Falp,ORF61,C21ORF61,1110025G12Rik |
| Target Alternative Names | 1110025G12Rik,B27,C21ORF61,C21orf61,FALP,FGD2,Falp,Fat cell-specific low molecular weight protein,Fat tissue-specific low MW protein,GCCD2,MRAP,MRAP1,Melanocortin-2 receptor accessory protein,Mrap,ORF61,RGD1310648 |
| Uniprot Accession |
Q8TCY5,Q9D159
Additional SwissProt Accessions: Q8TCY5,Q9D159 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | |
| Disease | |
| Disease from KEGG | Cortisol synthesis and secretion, Cushing syndrome |
| Gene Ensembl | ENSECAG00000012808, ENSBTAG00000023718, ENSG00000170262, ENSMMUG00000059677, ENSMUSG00000039956 |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


