Human TMEM47/BCMP1/DKFZp564E153 ORF/cDNA clone-Lentivirus plasmid (BC039242)

Cat. No.: pGMLP000068
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TMEM47/BCMP1/DKFZp564E153 Lentiviral expression plasmid for TMEM47 lentivirus packaging, TMEM47 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TMEM47/BCMP1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $436.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000068
Gene Name TMEM47
Accession Number BC039242
Gene ID 83604
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 546 bp
Gene Alias BCMP1,DKFZp564E153,DKFZP761J17121,MGC32949
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTTCGGCGGGCAGCGGCATGGAGGAGGTGCGCGTGTCGGTGCTGACCCCCTTGAAGCTGGTCGGGCTGGTGTGCATCTTCCTGGCGCTGTGTCTGGACCTGGGGGCGGTGCTGAGCCCGGCCTGGGTCACAGCTGACCACCAGTACTACCTGTCGTTGTGGGAGTCCTGCCGCAAACCCGCCAGCTTGGACATCTGGCACTGCGAGTCCACGCTCAGCAGCGATTGGCAGATTGCTACTCTGGCTTTACTCCTGGGCGGCGCTGCCATCATTCTCATTGCATTCCTGGTGGGTTTGATTTCTATCTGCGTGGGATCTCGAAGGCGTTTCTATAGACCTGTTGCGGTCATGCTTTTTGCAGCAGTTGTTTTACAGGTTTGCAGCCTGGTCCTTTACCCAATCAAGTTCATTGAAACTGTGAGCTTGAAAATTTACCATGAGTTCAACTGGGGTTATGGCCTGGCCTGGGGTGCAACTATATTTTCGTTTGGGGGTGCCATCCTTTATTGCCTGAACCCTAAGAACTATGAAGACTACTACTAG
ORF Protein Sequence MASAGSGMEEVRVSVLTPLKLVGLVCIFLALCLDLGAVLSPAWVTADHQYYLSLWESCRKPASLDIWHCESTLSSDWQIATLALLLGGAAIILIAFLVGLISICVGSRRRFYRPVAVMLFAAVVLQVCSLVLYPIKFIETVSLKIYHEFNWGYGLAWGATIFSFGGAILYCLNPKNYEDYY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1834-Ab Anti-TMM47/ TMEM47/ BCMP1 monoclonal antibody
    Target Antigen GM-Tg-g-MP1834-Ag TMEM47 VLP (virus-like particle)
    ORF Viral Vector pGMLP000068 Human TMEM47 Lentivirus plasmid
    ORF Viral Vector vGMLP000068 Human TMEM47 Lentivirus particle


    Target information

    Target ID GM-MP1834
    Target Name TMEM47
    Gene Group Identifier
    （Target Gene ID in Homo species)         		83604
    Gene ID 100629405 (Equus caballus), 101100625 (Felis catus), 192216 (Mus musculus), 403572 (Canis lupus familiaris)
    501569 (Rattus norvegicus), 541164 (Bos taurus), 693975 (Macaca mulatta), 83604 (Homo sapiens)
    Gene Symbols & Synonyms TMEM47,Tmem47,BCMP1,Tm4sf10,3010015F07Rik,RGD1564799,VAB-9,TM4SF10
    Target Alternative Names 3010015F07Rik,BCMP1,Brain cell membrane protein 1,RGD1564799,TM4SF10,TMEM47,Tm4sf10,Tmem47,Transmembrane 4 superfamily member 10,Transmembrane protein 47,VAB-9
    Uniprot Accession Q1JPA3,Q9BQJ4,Q9JJG6,Q9XSV3
    Additional SwissProt Accessions: Q9JJG6,Q9XSV3,Q1JPA3,Q9BQJ4
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000024307, ENSMUSG00000025666, ENSCAFG00845021814, ENSBTAG00000014304, ENSMMUG00000056731, ENSG00000147027
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.