Human CMTM6/CKLFSF6/PRO2219 ORF/cDNA clone-Lentivirus plasmid (NM_017801)
Cat. No.: pGMLP000070
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CMTM6/CKLFSF6/PRO2219 Lentiviral expression plasmid for CMTM6 lentivirus packaging, CMTM6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CMTM6/CKLFSF6 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLP000070 |
| Gene Name | CMTM6 |
| Accession Number | NM_017801 |
| Gene ID | 54918 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 552 bp |
| Gene Alias | CKLFSF6,PRO2219 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGAGAACGGAGCGGTGTACAGCCCCACTACGGAGGAGGACCCGGGCCCCGCCAGAGGCCCCCGGAGCGGCCTCGCTGCCTACTTTTTCATGGGCCGGCTCCCATTGCTCCGGCGCGTTCTCAAGGGCTTGCAGCTGTTGCTGTCTCTGCTGGCCTTCATCTGTGAAGAAGTTGTATCACAATGTACTTTATGTGGAGGACTTTATTTTTTTGAGTTTGTAAGCTGCAGTGCCTTTCTTCTGAGTCTCCTTATACTGATTGTGTATTGCACTCCATTTTATGAGAGAGTTGATACCACAAAAGTAAAATCATCGGATTTTTATATTACTTTGGGAACAGGATGTGTGTTTTTGTTGGCATCCATCATTTTTGTTTCCACACATGACAGGACTTCAGCTGAGATTGCTGCAATTGTGTTTGGATTTATAGCAAGTTTTATGTTCCTACTTGACTTTATCACTATGCTGTATGAAAAACGACAGGAGTCCCAGCTGAGAAAACCTGAAAATACCACTAGGGCTGAAGCCCTCACTGAGCCACTTAATGCCTAA |
| ORF Protein Sequence | MENGAVYSPTTEEDPGPARGPRSGLAAYFFMGRLPLLRRVLKGLQLLLSLLAFICEEVVSQCTLCGGLYFFEFVSCSAFLLSLLILIVYCTPFYERVDTTKVKSSDFYITLGTGCVFLLASIIFVSTHDRTSAEIAAIVFGFIASFMFLLDFITMLYEKRQESQLRKPENTTRAEALTEPLNA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0308-Ab | Anti-CKLF6/ CMTM6/ CKLFSF6 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0308-Ag | CMTM6 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP000070 | Human CMTM6 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000802 | Human CMTM6 Adenovirus plasmid |
| ORF Viral Vector | vGMLP000070 | Human CMTM6 Lentivirus particle |
| ORF Viral Vector | vGMAD000802 | Human CMTM6 Adenovirus particle |
Target information
| Target ID | GM-MP0308 |
| Target Name | CMTM6 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
54918 |
| Gene ID |
100630157 (Equus caballus), 101081491 (Felis catus), 316035 (Rattus norvegicus), 508881 (Bos taurus) 54918 (Homo sapiens), 609718 (Canis lupus familiaris), 67213 (Mus musculus), 704441 (Macaca mulatta) |
| Gene Symbols & Synonyms | CMTM6,Cmtm6,Da2-17,Cklfsf6,LRRGT00102,CKLFSF6,PRO2219,2810051A14Rik |
| Target Alternative Names | 2810051A14Rik,CKLF-like MARVEL transmembrane domain-containing protein 6,CKLFSF6,CMTM6,Chemokine-like factor superfamily member 6,Cklfsf6,Cmtm6,Da2-17,LRRGT00102,PRO2219 |
| Uniprot Accession |
Q9CZ69,Q9NX76
Additional SwissProt Accessions: Q9NX76,Q9CZ69 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | |
| Disease | |
| Disease from KEGG | |
| Gene Ensembl | ENSECAG00000038275, ENSBTAG00000019526, ENSG00000091317, ENSCAFG00845021780, ENSMUSG00000032434, ENSMMUG00000001443 |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


