Human CLPS ORF/cDNA clone-Lentivirus plasmid (NM_001832)

Cat. No.: pGMLP000077
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CLPS/ Lentiviral expression plasmid for CLPS lentivirus packaging, CLPS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CLPS products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000077
Gene Name CLPS
Accession Number NM_001832
Gene ID 1208
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 339 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGAAGATCCTGATCCTCCTGCTTGTCGCCCTCTCTGTGGCCTATGCAGCTCCTGGCCCCCGGGGGATCATTATCAACCTGGAGAACGGTGAGCTCTGCATGAATAGTGCCCAGTGTAAGAGCAATTGCTGCCAGCATTCAAGTGCGCTGGGCCTGGCCCGCTGCACATCCATGGCCAGCGAGAACAGCGAGTGCTCTGTCAAGACGCTCTATGGGATTTACTACAAGTGTCCCTGTGAGCGTGGCCTGACCTGTGAGGGAGACAAGACCATCGTGGGCTCCATCACCAACACCAACTTTGGCATCTGCCATGACGCTGGACGCTCCAAGCAGTGA
ORF Protein Sequence MEKILILLLVALSVAYAAPGPRGIIINLENGELCMNSAQCKSNCCQHSSALGLARCTSMASENSECSVKTLYGIYYKCPCERGLTCEGDKTIVGSITNTNFGICHDAGRSKQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0095-Ab Anti-COL/ CLPS functional antibody
    Target Antigen GM-Tg-g-SE0095-Ag CLPS protein
    ORF Viral Vector pGMLP000077 Human CLPS Lentivirus plasmid
    ORF Viral Vector vGMLP000077 Human CLPS Lentivirus particle


    Target information

    Target ID GM-SE0095
    Target Name CLPS
    Gene Group Identifier
    （Target Gene ID in Homo species)         		1208
    Gene ID 100053646 (Equus caballus), 101100391 (Felis catus), 109791 (Mus musculus), 1208 (Homo sapiens)
    25680 (Rattus norvegicus), 403970 (Canis lupus familiaris), 525923 (Bos taurus), 719005 (Macaca mulatta)
    Gene Symbols & Synonyms CLPS,Clps,CLPS1,CLPS2,2200003J09Rik,COLQ
    Target Alternative Names 2200003J09Rik,CLPS,CLPS1,CLPS2,COLQ,Clps,Colipase
    Uniprot Accession A0JNQ7,P02704,P02705,P04118,P17084,P19090,Q9CQC2
    Additional SwissProt Accessions: P02704,P02705,Q9CQC2,P04118,P17084,P19090,A0JNQ7
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG Fat digestion and absorption
    Gene Ensembl ENSECAG00000012160, ENSMUSG00000024225, ENSG00000137392, ENSBTAG00000062808, ENSMMUG00000015384
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.