Human TNFAIP6/TSG-6/TSG6 ORF/cDNA clone-Lentivirus plasmid (NM_007115)

Cat. No.: pGMLP000090
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TNFAIP6/TSG-6/TSG6 Lentiviral expression plasmid for TNFAIP6 lentivirus packaging, TNFAIP6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TSG-6/TNFAIP6/TNFAIP6/TSG-6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $508.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000090
Gene Name TNFAIP6
Accession Number NM_007115
Gene ID 7130
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 834 bp
Gene Alias TSG-6,TSG6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGATCATCTTAATTTACTTATTTCTCTTGCTATGGGAAGACACTCAAGGATGGGGATTCAAGGATGGAATTTTTCATAACTCCATATGGCTTGAACGAGCAGCCGGTGTGTACCACAGAGAAGCACGGTCTGGCAAATACAAGCTCACCTACGCAGAAGCTAAGGCGGTGTGTGAATTTGAAGGCGGCCATCTCGCAACTTACAAGCAGCTAGAGGCAGCCAGAAAAATTGGATTTCATGTCTGTGCTGCTGGATGGATGGCTAAGGGCAGAGTTGGATACCCCATTGTGAAGCCAGGGCCCAACTGTGGATTTGGAAAAACTGGCATTATTGATTATGGAATCCGTCTCAATAGGAGTGAAAGATGGGATGCCTATTGCTACAACCCACACGCAAAGGAGTGTGGTGGCGTCTTTACAGATCCAAAGCAAATTTTTAAATCTCCAGGCTTCCCAAATGAGTACGAAGATAACCAAATCTGCTACTGGCACATTAGACTCAAGTATGGTCAGCGTATTCACCTGAGTTTTTTAGATTTTGACCTTGAAGATGACCCAGGTTGCTTGGCTGATTATGTTGAAATATATGACAGTTACGATGATGTCCATGGCTTTGTGGGAAGATACTGTGGAGATGAGCTTCCAGATGACATCATCAGTACAGGAAATGTCATGACCTTGAAGTTTCTAAGTGATGCTTCAGTGACAGCTGGAGGTTTCCAAATCAAATATGTTGCAATGGATCCTGTATCCAAATCCAGTCAAGGAAAAAATACAAGTACTACTTCTACTGGAAATAAAAACTTTTTAGCTGGAAGATTTAGCCACTTATAA
ORF Protein Sequence MIILIYLFLLLWEDTQGWGFKDGIFHNSIWLERAAGVYHREARSGKYKLTYAEAKAVCEFEGGHLATYKQLEAARKIGFHVCAAGWMAKGRVGYPIVKPGPNCGFGKTGIIDYGIRLNRSERWDAYCYNPHAKECGGVFTDPKQIFKSPGFPNEYEDNQICYWHIRLKYGQRIHLSFLDFDLEDDPGCLADYVEIYDSYDDVHGFVGRYCGDELPDDIISTGNVMTLKFLSDASVTAGGFQIKYVAMDPVSKSSQGKNTSTTSTGNKNFLAGRFSHL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1343-Ab Anti-TSG6/ TNFAIP6/ TSG-6 functional antibody
    Target Antigen GM-Tg-g-SE1343-Ag TNFAIP6 protein
    Cytokine cks-Tg-g-GM-SE1343 tumor necrosis factor, alpha-induced protein 6 (TNFAIP6) protein & antibody
    ORF Viral Vector pGMLP000090 Human TNFAIP6 Lentivirus plasmid
    ORF Viral Vector vGMLP000090 Human TNFAIP6 Lentivirus particle


    Target information

    Target ID GM-SE1343
    Target Name TSG-6/TNFAIP6
    Gene Group Identifier
    （Target Gene ID in Homo species)         		7130
    Gene ID 100034068 (Equus caballus), 101100655 (Felis catus), 21930 (Mus musculus), 476147 (Canis lupus familiaris)
    493710 (Bos taurus), 694699 (Macaca mulatta), 7130 (Homo sapiens), 84397 (Rattus norvegicus)
    Gene Symbols & Synonyms TNFAIP6,Tnfaip6,TSG-6,Tsg6,Tnfip6,tsg-6,TSG6
    Target Alternative Names Hyaluronate-binding protein,TNF-stimulated gene 6 protein (TSG-6),TNFAIP6,TSG-6,TSG6,Tnfaip6,Tnfip6,Tsg6,Tumor necrosis factor alpha-induced protein 6 (TNF alpha-induced protein 6),Tumor necrosis factor-inducible gene 6 protein,tsg-6
    Uniprot Accession O08859,P98066
    Additional SwissProt Accessions: O08859,P98066
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Ovary Cancer
    Disease from KEGG
    Gene Ensembl ENSECAG00000012104, ENSMUSG00000053475, ENSCAFG00845008460, ENSBTAG00000007239, ENSMMUG00000010927, ENSG00000123610
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.