Human GJB3/CX31/DFNA2 ORF/cDNA clone-Lentivirus plasmid (NM_024009)

Cat. No.: pGMLP000126
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GJB3/CX31/DFNA2 Lentiviral expression plasmid for GJB3 lentivirus packaging, GJB3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to GJB3/Cx31/GJB3/CX31 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $503.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000126
Gene Name GJB3
Accession Number NM_024009
Gene ID 2707
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 813 bp
Gene Alias CX31,DFNA2,DFNA2B,EKV,EKVP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACTGGAAGACACTCCAGGCCCTACTGAGCGGTGTGAACAAGTACTCCACAGCGTTCGGGCGCATCTGGCTGTCCGTGGTGTTCGTCTTCCGGGTGCTGGTATACGTGGTGGCTGCAGAGCGCGTGTGGGGGGATGAGCAGAAGGACTTTGACTGCAACACCAAGCAGCCCGGCTGCACCAACGTCTGCTACGACAACTACTTCCCCATCTCCAACATCCGCCTCTGGGCCCTGCAGCTCATCTTCGTCACATGCCCCTCGCTGCTGGTCATCCTGCACGTGGCCTACCGTGAGGAGCGGGAGCGCCGGCACCGCCAGAAACACGGGGACCAGTGCGCCAAGCTGTACGACAACGCAGGCAAGAAGCACGGAGGCCTGTGGTGGACCTACCTGTTCAGCCTCATCTTCAAGCTCATCATTGAGTTCCTCTTCCTCTACCTGCTGCACACTCTCTGGCATGGCTTCAATATGCCGCGCCTGGTGCAGTGTGCCAACGTGGCCCCCTGCCCCAACATCGTGGACTGCTACATTGCCCGACCTACCGAGAAGAAAATCTTCACCTACTTCATGGTGGGCGCCTCCGCCGTCTGCATCGTACTCACCATCTGTGAGCTCTGCTACCTCATCTGCCACAGGGTCCTGCGAGGCCTGCACAAGGACAAGCCTCGAGGGGGTTGCAGCCCCTCGTCCTCCGCCAGCCGAGCTTCCACCTGCCGCTGCCACCACAAGCTGGTGGAGGCTGGGGAGGTGGATCCAGACCCAGGCAATAACAAGCTGCAGGCTTCAGCACCCAACCTGACCCCCATCTGA
ORF Protein Sequence MDWKTLQALLSGVNKYSTAFGRIWLSVVFVFRVLVYVVAAERVWGDEQKDFDCNTKQPGCTNVCYDNYFPISNIRLWALQLIFVTCPSLLVILHVAYREERERRHRQKHGDQCAKLYDNAGKKHGGLWWTYLFSLIFKLIIEFLFLYLLHTLWHGFNMPRLVQCANVAPCPNIVDCYIARPTEKKIFTYFMVGASAVCIVLTICELCYLICHRVLRGLHKDKPRGGCSPSSSASRASTCRCHHKLVEAGEVDPDPGNNKLQASAPNLTPI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0171-Ab Anti-Cx31 monoclonal antibody
    Target Antigen GM-Tg-g-IP0171-Ag Cx31/GJB3 protein
    ORF Viral Vector pGMLP000126 Human GJB3 Lentivirus plasmid
    ORF Viral Vector vGMLP000126 Human GJB3 Lentivirus particle


    Target information

    Target ID GM-IP0171
    Target Name GJB3/Cx31
    Gene Group Identifier
    （Target Gene ID in Homo species)         		2707
    Gene ID 100055573 (Equus caballus), 101083782 (Felis catus), 14620 (Mus musculus), 2707 (Homo sapiens)
    29585 (Rattus norvegicus), 482486 (Canis lupus familiaris), 539935 (Bos taurus), 710834 (Macaca mulatta)
    Gene Symbols & Synonyms GJB3,Gjb3,CXNC,Cx31,Cxnc,Cnx31,Gjb-3,D4Wsu144e,EKV,CX31,DFNA2,EKVP1,DFNA2B
    Target Alternative Names CX31,CXNC,Cnx31,Connexin-31 (Cx31),Cx31,Cxnc,D4Wsu144e,DFNA2,DFNA2B,EKV,EKVP1,GJB3,Gap junction beta-3 protein,Gjb-3,Gjb3
    Uniprot Accession O75712,P25305,P28231,Q58D78
    Additional SwissProt Accessions: P28231,O75712,P25305,Q58D78
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000005150, ENSMUSG00000042367, ENSG00000188910, ENSCAFG00845015452, ENSBTAG00000064062, ENSMMUG00000022677
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.