Human HLA-DRB5 ORF/cDNA clone-Lentivirus plasmid (NM_002125)

Cat. No.: pGMLP000128
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HLA-DRB5/ Lentiviral expression plasmid for HLA-DRB5 lentivirus packaging, HLA-DRB5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to HLA-DRB5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $500.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000128
Gene Name HLA-DRB5
Accession Number NM_002125
Gene ID 3127
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 801 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGTGTCTGAAGCTCCCTGGAGGTTCCTACATGGCAAAGCTGACAGTGACACTGATGGTGCTGAGCTCCCCACTGGCTTTGGCTGGGGACACCCGACCACGTTTCTTGCAGCAGGATAAGTATGAGTGTCATTTCTTCAACGGGACGGAGCGGGTGCGGTTCCTGCACAGAGACATCTATAACCAAGAGGAGGACTTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGACGGAGCTGGGGCGGCCTGACGCTGAGTACTGGAACAGCCAGAAGGACTTCCTGGAAGACAGGCGCGCCGCGGTGGACACCTACTGCAGACACAACTACGGGGTTGGTGAGAGCTTCACAGTGCAGCGGCGAGTTGAGCCTAAGGTGACTGTGTATCCTGCAAGGACCCAGACCCTGCAGCACCACAACCTCCTGGTCTGCTCTGTGAATGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACAGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACAGGCCTGATTCAGAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCGAAGTGGAGAGGTTTACACCTGCCAAGTGGAGCACCCAAGCGTGACGAGCCCTCTCACAGTGGAATGGAGAGCACAGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTATTCATCTACTTCAAGAATCAGAAAGGGCACTCTGGACTTCACCCAACAGGACTCGTGAGCTGA
ORF Protein Sequence MVCLKLPGGSYMAKLTVTLMVLSSPLALAGDTRPRFLQQDKYECHFFNGTERVRFLHRDIYNQEEDLRFDSDVGEYRAVTELGRPDAEYWNSQKDFLEDRRAAVDTYCRHNYGVGESFTVQRRVEPKVTVYPARTQTLQHHNLLVCSVNGFYPGSIEVRWFRNSQEEKAGVVSTGLIQNGDWTFQTLVMLETVPRSGEVYTCQVEHPSVTSPLTVEWRAQSESAQSKMLSGVGGFVLGLLFLGAGLFIYFKNQKGHSGLHPTGLVS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA180-Ab Anti-DRB5/ HLA-DRB5 monoclonal antibody
    Target Antigen GM-Tg-g-TA180-Ag HLA-DRB5 VLP (virus-like particle)
    ORF Viral Vector pGMLP000128 Human HLA-DRB5 Lentivirus plasmid
    ORF Viral Vector vGMLP000128 Human HLA-DRB5 Lentivirus particle


    Target information

    Target ID GM-TA180
    Target Name HLA-DRB5
    Gene Group Identifier
    （Target Gene ID in Homo species)         		3127
    Gene ID 3127 (Homo sapiens)
    Gene Symbols & Synonyms HLA-DRB5,DRB5,HLA-DRB5*
    Target Alternative Names DR beta 5 chain,DR beta-5,DR2-beta-2,DRB5,Dw2,HLA class II histocompatibility antigen,HLA-DRB5,HLA-DRB5*,MHC class II antigen DRB5
    Uniprot Accession Q30154
    Additional SwissProt Accessions: Q30154
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Phagosome, Cell adhesion molecules, Antigen processing and presentation, Hematopoietic cell lineage, Th1 and Th2 cell differentiation, Th17 cell differentiation, Intestinal immune network for IgA production, Type I diabetes mellitus, Leishmaniasis, Toxoplasmosis, Staphylococcus aureus infection, Tuberculosis, Influenza A, Human T-cell leukemia virus 1 infection, Epstein-Barr virus infection, Asthma, Autoimmune thyroid disease, Inflammatory bowel disease, Rheumatoid arthritis, Allograft rejection, Graft-versus-host disease, Viral myocarditis
    Gene Ensembl ENSG00000198502
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.