Human IFNA13 ORF/cDNA clone-Lentivirus plasmid (NM_006900)
Cat. No.: pGMLP000155
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human IFNA13/ Lentiviral expression plasmid for IFNA13 lentivirus packaging, IFNA13 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
IFNA13/Interferon alpha 1/IFNA1/IFNA13 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLP000155 |
| Gene Name | IFNA13 |
| Accession Number | NM_006900 |
| Gene ID | 3447 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 573 bp |
| Gene Alias | |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGATGGCCTCGCCCTTTGCTTTACTGATGGCCCTGGTGGTGCTCAGCTGCAAGTCAAGCTGCTCTCTGGGCTGTGATCTCCCTGAGACCCACAGCCTGGATAACAGGAGGACCTTGATGCTCCTGGCACAAATGAGCAGAATCTCTCCTTCCTCCTGTCTGATGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGATGGCAACCAGTTCCAGAAGGCTCCAGCCATCTCTGTCCTCCATGAGCTGATCCAGCAGATCTTCAACCTCTTTACCACAAAAGATTCATCTGCTGCTTGGGATGAGGACCTCCTAGACAAATTCTGCACCGAACTCTACCAGCAGCTGAATGACTTGGAAGCCTGTGTGATGCAGGAGGAGAGGGTGGGAGAAACTCCCCTGATGAATGCGGACTCCATCTTGGCTGTGAAGAAATACTTCCGAAGAATCACTCTCTATCTGACAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCCTCTCTTTATCAACAAACTTGCAAGAAAGATTAAGGAGGAAGGAATAA |
| ORF Protein Sequence | MMASPFALLMALVVLSCKSSCSLGCDLPETHSLDNRRTLMLLAQMSRISPSSCLMDRHDFGFPQEEFDGNQFQKAPAISVLHELIQQIFNLFTTKDSSAAWDEDLLDKFCTELYQQLNDLEACVMQEERVGETPLMNADSILAVKKYFRRITLYLTEKKYSPCAWEVVRAEIMRSLSLSTNLQERLRRKE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE0977-Ab | Anti-IFNA1/ IFNA13 functional antibody |
| Target Antigen | GM-Tg-g-SE0977-Ag | IFNA13 protein |
| Cytokine | cks-Tg-g-GM-SE0977 | interferon, alpha 13 (IFNA13) protein & antibody |
| ORF Viral Vector | pGMLP000155 | Human IFNA13 Lentivirus plasmid |
| ORF Viral Vector | pGMLP000551 | Human IFNA1 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000576 | Human IFNA1 Adenovirus plasmid |
| ORF Viral Vector | pGMAP000481 | Human IFNA1 Adenovirus plasmid |
| ORF Viral Vector | vGMLP000155 | Human IFNA13 Lentivirus particle |
| ORF Viral Vector | vGMLP000551 | Human IFNA1 Lentivirus particle |
| ORF Viral Vector | vGMAD000576 | Human IFNA1 Adenovirus particle |
| ORF Viral Vector | vGMAP000481 | Human IFNA1 Adenovirus particle |
Target information
| Target ID | GM-SE0977 |
| Target Name | IFNA13/Interferon alpha 1/IFNA1 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
3447 |
| Gene ID | |
| Gene Symbols & Synonyms | |
| Target Alternative Names | IFN-alpha-1/13,IFNA1,IFNA13,Interferon alpha 1,Interferon alpha-1/13,Interferon alpha-D (LeIF D) |
| Uniprot Accession | |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Cytokine Target |
| Disease | |
| Disease from KEGG | Cytokine-cytokine receptor interaction, PI3K-Akt signaling pathway, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, JAK-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Alcoholic liver disease, Tuberculosis, Hepatitis C, Hepatitis B, Measles, Human cytomegalovirus infection, Influenza A, Human papillomavirus infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Autoimmune thyroid disease, Lipid and atherosclerosis |
| Gene Ensembl | |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


