Human KLK4/AI2A1/ARM1 ORF/cDNA clone-Lentivirus plasmid (NM_004917)

Cat. No.: pGMLP000166
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KLK4/AI2A1/ARM1 Lentiviral expression plasmid for KLK4 lentivirus packaging, KLK4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to KLK4/AI2A1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $491.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000166
Gene Name KLK4
Accession Number NM_004917
Gene ID 9622
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 765 bp
Gene Alias AI2A1,ARM1,EMSP,EMSP1,kallikrein,KLK-L1,PRSS17,PSTS
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCACAGCAGGAAATCCCTGGGGCTGGTTCCTGGGGTACCTCATCCTTGGTGTCGCAGGATCGCTCGTCTCTGGTAGCTGCAGCCAAATCATAAACGGCGAGGACTGCAGCCCGCACTCGCAGCCCTGGCAGGCGGCACTGGTCATGGAAAACGAATTGTTCTGCTCGGGCGTCCTGGTGCATCCGCAGTGGGTGCTGTCAGCCGCACACTGTTTCCAGAACTCCTACACCATCGGGCTGGGCCTGCACAGTCTTGAGGCCGACCAAGAGCCAGGGAGCCAGATGGTGGAGGCCAGCCTCTCCGTACGGCACCCAGAGTACAACAGACCCTTGCTCGCTAACGACCTCATGCTCATCAAGTTGGACGAATCCGTGTCCGAGTCTGACACCATCCGGAGCATCAGCATTGCTTCGCAGTGCCCTACCGCGGGGAACTCTTGCCTCGTTTCTGGCTGGGGTCTGCTGGCGAACGGCAGAATGCCTACCGTGCTGCAGTGCGTGAACGTGTCGGTGGTGTCTGAGGAGGTCTGCAGTAAGCTCTATGACCCGCTGTACCACCCCAGCATGTTCTGCGCCGGCGGAGGGCAAGACCAGAAGGACTCCTGCAACGGTGACTCTGGGGGGCCCCTGATCTGCAACGGGTACTTGCAGGGCCTTGTGTCTTTCGGAAAAGCCCCGTGTGGCCAAGTTGGCGTGCCAGGTGTCTACACCAACCTCTGCAAATTCACTGAGTGGATAGAGAAAACCGTCCAGGCCAGTTAA
ORF Protein Sequence MATAGNPWGWFLGYLILGVAGSLVSGSCSQIINGEDCSPHSQPWQAALVMENELFCSGVLVHPQWVLSAAHCFQNSYTIGLGLHSLEADQEPGSQMVEASLSVRHPEYNRPLLANDLMLIKLDESVSESDTIRSISIASQCPTAGNSCLVSGWGLLANGRMPTVLQCVNVSVVSEEVCSKLYDPLYHPSMFCAGGGQDQKDSCNGDSGGPLICNGYLQGLVSFGKAPCGQVGVPGVYTNLCKFTEWIEKTVQAS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T79400-Ab Anti-KLK4/ AI2A1/ ARM1 functional antibody
    Target Antigen GM-Tg-g-T79400-Ag KLK4 protein
    ORF Viral Vector pGMLP000166 Human KLK4 Lentivirus plasmid
    ORF Viral Vector vGMLP000166 Human KLK4 Lentivirus particle


    Target information

    Target ID GM-T79400
    Target Name KLK4
    Gene Group Identifier
    （Target Gene ID in Homo species)         		9622
    Gene ID 101089560 (Felis catus), 408210 (Rattus norvegicus), 484354 (Canis lupus familiaris), 507800 (Bos taurus)
    56640 (Mus musculus), 719422 (Macaca mulatta), 9622 (Homo sapiens)
    Gene Symbols & Synonyms KLK4,Klk4,Emsp1,Klnb1,KLNB1,PSTS,ESMP1,KLK-L1,Prss17,ARM1,EMSP,AI2A1,EMSP1,PRSS17,kallikrein
    Target Alternative Names AI2A1,ARM1,EMSP,EMSP1,ESMP1,Emsp1,Enamel matrix serine proteinase 1,KLK-L1,KLK4,KLNB1,Kallikrein-4,Kallikrein-like protein 1 (KLK-L1),Klk4,Klnb1,PRSS17,PSTS,Prostase,Prss17,Serine protease 17,kallikrein
    Uniprot Accession Q9Y5K2,Q9Z0M1
    Additional SwissProt Accessions: Q9Z0M1,Q9Y5K2
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSBTAG00000020415, ENSMUSG00000006948, ENSMMUG00000028729, ENSG00000167749
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.