Human CLN8/C8orf61/EPMR ORF/cDNA clone-Lentivirus plasmid (NM_018941)

Cat. No.: pGMLP000179
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CLN8/C8orf61/EPMR Lentiviral expression plasmid for CLN8 lentivirus packaging, CLN8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CLN8/C8orf61 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $515.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000179
Gene Name CLN8
Accession Number NM_018941
Gene ID 2055
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 861 bp
Gene Alias C8orf61,EPMR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAATCCTGCGAGCGATGGGGGCACATCAGAGAGCATTTTTGACCTGGACTATGCATCCTGGGGGATCCGCTCCACGCTGATGGTCGCTGGCTTTGTCTTCTACTTGGGCGTCTTTGTGGTCTGCCACCAGCTGTCCTCTTCCCTGAATGCCACTTACCGTTCTTTGGTGGCCAGAGAGAAGGTCTTCTGGGACCTGGCGGCCACGCGTGCAGTCTTTGGTGTTCAGAGCACAGCCGCAGGCCTGTGGGCTCTGCTGGGGGACCCTGTGCTGCATGCCGACAAGGCGCGTGGCCAGCAGAACTGGTGCTGGTTTCACATCACGACAGCAACGGGATTCTTTTGCTTTGAAAATGTTGCAGTCCACCTGTCCAACTTGATCTTCCGGACATTTGACTTGTTTCTGGTTATCCACCATCTCTTTGCCTTTCTTGGGTTTCTTGGCTGCTTGGTCAATCTCCAAGCTGGCCACTATCTAGCTATGACCACGTTGCTCCTGGAGATGAGCACGCCCTTTACCTGCGTTTCCTGGATGCTCTTAAAGGCGGGCTGGTCCGAGTCTCTGTTTTGGAAGCTCAACCAGTGGCTGATGATTCACATGTTTCACTGCCGCATGGTTCTAACCTACCACATGTGGTGGGTGTGTTTCTGGCACTGGGACGGCCTGGTCAGCAGCCTGTATCTGCCTCATTTGACACTGTTCCTTGTCGGACTGGCTCTGCTTACGCTAATCATTAATCCATATTGGACCCATAAGAAGACTCAGCAGCTTCTCAATCCGGTGGACTGGAACTTCGCACAGCCAGAAGCCAAGAGCAGGCCAGAAGGCAACGGGCAGCTGCTGCGGAAGAAGAGGCCATAG
ORF Protein Sequence MNPASDGGTSESIFDLDYASWGIRSTLMVAGFVFYLGVFVVCHQLSSSLNATYRSLVAREKVFWDLAATRAVFGVQSTAAGLWALLGDPVLHADKARGQQNWCWFHITTATGFFCFENVAVHLSNLIFRTFDLFLVIHHLFAFLGFLGCLVNLQAGHYLAMTTLLLEMSTPFTCVSWMLLKAGWSESLFWKLNQWLMIHMFHCRMVLTYHMWWVCFWHWDGLVSSLYLPHLTLFLVGLALLTLIINPYWTHKKTQQLLNPVDWNFAQPEAKSRPEGNGQLLRKKRP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0563-Ab Anti-CLN8 monoclonal antibody
    Target Antigen GM-Tg-g-IP0563-Ag CLN8 protein
    ORF Viral Vector pGMLP000179 Human CLN8 Lentivirus plasmid
    ORF Viral Vector vGMLP000179 Human CLN8 Lentivirus particle


    Target information

    Target ID GM-IP0563
    Target Name CLN8
    Gene Group Identifier
    (Target Gene ID in Homo species)
    2055
    Gene ID 100065372 (Equus caballus), 101100714 (Felis catus), 2055 (Homo sapiens), 26889 (Mus musculus)
    306619 (Rattus norvegicus), 488558 (Canis lupus familiaris), 530874 (Bos taurus), 716441 (Macaca mulatta)
    Gene Symbols & Synonyms CLN8,Cln8,EPMR,TLCD6,C8orf61,mnd,Tlcd6
    Target Alternative Names C8orf61,CLN8,Cln8,EPMR,Protein CLN8,TLCD6,Tlcd6,mnd
    Uniprot Accession Q5JZQ7,Q6AYM9,Q9QUK3,Q9UBY8
    Additional SwissProt Accessions: Q9UBY8,Q9QUK3,Q6AYM9,Q5JZQ7
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSG00000182372, ENSMUSG00000026317, ENSCAFG00845019093, ENSMMUG00000009470
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.