Human CD3G/CD3-GAMMA/IMD17 ORF/cDNA clone-Lentivirus plasmid (NM_000073)

Cat. No.: pGMLP000197
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD3G/CD3-GAMMA/IMD17 Lentiviral expression plasmid for CD3G lentivirus packaging, CD3G lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CD3 Gamma/CD3G/CD3g/CD3G/CD3-GAMMA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $437.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000197
Gene Name CD3G
Accession Number NM_000073
Gene ID 917
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 549 bp
Gene Alias CD3-GAMMA,IMD17,T3G
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAACAGGGGAAGGGCCTGGCTGTCCTCATCCTGGCTATCATTCTTCTTCAAGGTACTTTGGCCCAGTCAATCAAAGGAAACCACTTGGTTAAGGTGTATGACTATCAAGAAGATGGTTCGGTACTTCTGACTTGTGATGCAGAAGCCAAAAATATCACATGGTTTAAAGATGGGAAGATGATCGGCTTCCTAACTGAAGATAAAAAAAAATGGAATCTGGGAAGTAATGCCAAGGACCCTCGAGGGATGTATCAGTGTAAAGGATCACAGAACAAGTCAAAACCACTCCAAGTGTATTACAGAATGTGTCAGAACTGCATTGAACTAAATGCAGCCACCATATCTGGCTTTCTCTTTGCTGAAATCGTCAGCATTTTCGTCCTTGCTGTTGGGGTCTACTTCATTGCTGGACAGGATGGAGTTCGCCAGTCGAGAGCTTCAGACAAGCAGACTCTGTTGCCCAATGACCAGCTCTACCAGCCCCTCAAGGATCGAGAAGATGACCAGTACAGCCACCTTCAAGGAAACCAGTTGAGGAGGAATTGA
ORF Protein Sequence MEQGKGLAVLILAIILLQGTLAQSIKGNHLVKVYDYQEDGSVLLTCDAEAKNITWFKDGKMIGFLTEDKKKWNLGSNAKDPRGMYQCKGSQNKSKPLQVYYRMCQNCIELNAATISGFLFAEIVSIFVLAVGVYFIAGQDGVRQSRASDKQTLLPNDQLYQPLKDREDDQYSHLQGNQLRRN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T18972-Ab Anti-CD3G/ CD3-GAMMA/ IMD17 monoclonal antibody
    Target Antigen GM-Tg-g-T18972-Ag CD3G VLP (virus-like particle)
    ORF Viral Vector pGMLP000197 Human CD3G Lentivirus plasmid
    ORF Viral Vector vGMLP000197 Human CD3G Lentivirus particle


    Target information

    Target ID GM-T18972
    Target Name CD3 Gamma/CD3G/CD3g
    Gene Group Identifier
    (Target Gene ID in Homo species)
    917
    Gene ID 100062960 (Equus caballus), 101089292 (Felis catus), 12502 (Mus musculus), 281055 (Bos taurus)
    300678 (Rattus norvegicus), 489383 (Canis lupus familiaris), 705270 (Macaca mulatta), 917 (Homo sapiens)
    Gene Symbols & Synonyms CD3G,Cd3g,T3g,Ctg3,Ctg-3,T3G,IMD17,CD3GAMMA,CD3-GAMMA
    Target Alternative Names CD3 Gamma,CD3-GAMMA,CD3G,CD3GAMMA,CD3g,Cd3g,Ctg-3,Ctg3,IMD17,T-cell receptor T3 gamma chain,T-cell surface glycoprotein CD3 gamma chain,T3G,T3g
    Uniprot Accession P09693,P11942,Q28074,Q64159
    Additional SwissProt Accessions: P11942,Q28074,Q64159,P09693
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Hematopoietic cell lineage, Th1 and Th2 cell differentiation, Th17 cell differentiation, T cell receptor signaling pathway, Chagas disease, Measles, Human T-cell leukemia virus 1 infection, Epstein-Barr virus infection, PD-L1 expression and PD-1 checkpoint pathway in cancer
    Gene Ensembl ENSECAG00000005081, ENSMUSG00000002033, ENSBTAG00000006453, ENSCAFG00845002392, ENSMMUG00000017600, ENSG00000160654
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.