Human TOLLIP/IL-1RAcPIP ORF/cDNA clone-Lentivirus plasmid (NM_019009)

Cat. No.: pGMLP000225
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TOLLIP/IL-1RAcPIP Lentiviral expression plasmid for TOLLIP lentivirus packaging, TOLLIP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TOLLIP/IL-1RAcPIP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $506.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000225
Gene Name TOLLIP
Accession Number NM_019009
Gene ID 54472
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 825 bp
Gene Alias IL-1RAcPIP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGACCACCGTCAGCACTCAGCGCGGGCCGGTGTACATCGGTGAGCTCCCGCAGGACTTCCTCCGCATCACGCCCACACAGCAGCAGCGGCAGGTCCAGCTGGACGCCCAGGCGGCCCAGCAGCTGCAGTACGGAGGCGCAGTGGGCACCGTGGGCCGACTGAACATCACGGTGGTACAGGCAAAGTTGGCCAAGAATTACGGCATGACCCGCATGGACCCCTACTGCCGACTGCGCCTGGGCTACGCGGTGTACGAGACGCCCACGGCACACAATGGCGCCAAGAATCCCCGCTGGAATAAGGTCATCCACTGCACGGTGCCCCCAGGCGTGGACTCTTTCTATCTCGAGATCTTCGATGAGAGAGCCTTCTCCATGGACGACCGCATTGCCTGGACCCACATCACCATCCCGGAGTCCCTGAGGCAGGGCAAGGTGGAGGACAAGTGGTACAGCCTGAGCGGGAGGCAGGGGGACGACAAGGAGGGCATGATCAACCTCGTCATGTCCTACGCGCTGCTTCCAGCTGCCATGGTGATGCCACCCCAGCCCGTGGTCCTGATGCCAACAGTGTACCAGCAGGGCGTTGGCTATGTGCCCATCACAGGGATGCCCGCTGTCTGTAGCCCCGGCATGGTGCCCGTGGCCCTGCCCCCGGCCGCCGTGAACGCCCAGCCCCGCTGTAGCGAGGAGGACCTGAAAGCCATCCAGGACATGTTCCCCAACATGGACCAGGAGGTGATCCGCTCCGTGCTGGAAGCCCAGCGAGGGAACAAGGATGCCGCCATCAACTCCCTGCTGCAGATGGGGGAGGAGCCATAG
ORF Protein Sequence MATTVSTQRGPVYIGELPQDFLRITPTQQQRQVQLDAQAAQQLQYGGAVGTVGRLNITVVQAKLAKNYGMTRMDPYCRLRLGYAVYETPTAHNGAKNPRWNKVIHCTVPPGVDSFYLEIFDERAFSMDDRIAWTHITIPESLRQGKVEDKWYSLSGRQGDDKEGMINLVMSYALLPAAMVMPPQPVVLMPTVYQQGVGYVPITGMPAVCSPGMVPVALPPAAVNAQPRCSEEDLKAIQDMFPNMDQEVIRSVLEAQRGNKDAAINSLLQMGEEP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0609-Ab Anti-TOLIP/ TOLLIP/ IL-1RAcPIP functional antibody
    Target Antigen GM-Tg-g-SE0609-Ag TOLLIP protein
    ORF Viral Vector pGMLP000225 Human TOLLIP Lentivirus plasmid
    ORF Viral Vector vGMLP000225 Human TOLLIP Lentivirus particle


    Target information

    Target ID GM-SE0609
    Target Name TOLLIP
    Gene Group Identifier
    （Target Gene ID in Homo species)         		54472
    Gene ID 100051383 (Equus caballus), 101095614 (Felis catus), 361677 (Rattus norvegicus), 483657 (Canis lupus familiaris)
    539480 (Bos taurus), 54472 (Homo sapiens), 54473 (Mus musculus), 702587 (Macaca mulatta)
    Gene Symbols & Synonyms TOLLIP,Tollip,IL-1RAcPIP,4930403G24Rik,4931428G15Rik
    Target Alternative Names 4930403G24Rik,4931428G15Rik,IL-1RAcPIP,TOLLIP,Toll-interacting protein,Tollip
    Uniprot Accession A2RUW1,Q2LGB5,Q9H0E2,Q9QZ06
    Additional SwissProt Accessions: A2RUW1,Q2LGB5,Q9H0E2,Q9QZ06
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG Toll-like receptor signaling pathway
    Gene Ensembl ENSECAG00000019235, ENSCAFG00845008798, ENSBTAG00000008237, ENSG00000078902, ENSMUSG00000025139, ENSMMUG00000003104
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.