Human SPRY2/hSPRY2/IGAN3 ORF/cDNA clone-Lentivirus plasmid (NM_005842)

Cat. No.: pGMLP000306
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SPRY2/hSPRY2/IGAN3 Lentiviral expression plasmid for SPRY2 lentivirus packaging, SPRY2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to SPRY2/hSPRY2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $537
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000306
Gene Name SPRY2
Accession Number NM_005842
Gene ID 10253
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 948 bp
Gene Alias hSPRY2,IGAN3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGCCAGAGCTCAGAGTGGCAACGGGTCGCAGCCCTTGCTGCAGACGCCCCGTGACGGTGGCAGACAGCGTGGGGAGCCCGACCCCAGAGACGCCCTCACCCAGCAGGTACATGTCTTGTCTCTGGATCAGATCAGAGCCATCCGAAACACCAATGAGTACACAGAGGGGCCTACTGTCGTCCCAAGACCTGGGCTCAAGCCTGCTCCTCGCCCCTCCACTCAGCACAAACACGAGAGACTCCACGGTCTGCCTGAGCACCGCCAGCCTCCTAGGCTCCAGCACTCGCAGGTCCATTCTTCTGCACGAGCCCCTCTGTCCAGATCCATAAGCACGGTCAGCTCAGGGTCGCGGAGCAGTACGAGGACAAGTACCAGCAGCAGCTCCTCTGAACAGAGACTGCTAGGATCATCCTTCTCCTCCGGGCCTGTTGCTGATGGCATAATCCGGGTGCAACCCAAATCTGAGCTCAAGCCAGGTGAGCTTAAGCCACTGAGCAAGGAAGATTTGGGCCTGCACGCCTACAGGTGTGAGGACTGTGGCAAGTGCAAATGTAAGGAGTGCACCTACCCAAGGCCTCTGCCATCAGACTGGATCTGCGACAAGCAGTGCCTTTGCTCGGCCCAGAACGTGATTGACTATGGGACTTGTGTATGCTGTGTGAAAGGTCTCTTCTATCACTGTTCTAATGATGATGAGGACAACTGTGCTGACAACCCATGTTCTTGCAGCCAGTCTCACTGTTGTACACGATGGTCAGCCATGGGTGTCATGTCCCTCTTTTTGCCTTGTTTATGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGGTGTTATGACCGGGTTAACAGGCCTGGTTGCCGCTGTAAAAACTCAAACACAGTTTGCTGCAAAGTTCCCACTGTCCCCCCTAGGAACTTTGAAAAACCAACATAG
ORF Protein Sequence MEARAQSGNGSQPLLQTPRDGGRQRGEPDPRDALTQQVHVLSLDQIRAIRNTNEYTEGPTVVPRPGLKPAPRPSTQHKHERLHGLPEHRQPPRLQHSQVHSSARAPLSRSISTVSSGSRSSTRTSTSSSSSEQRLLGSSFSSGPVADGIIRVQPKSELKPGELKPLSKEDLGLHAYRCEDCGKCKCKECTYPRPLPSDWICDKQCLCSAQNVIDYGTCVCCVKGLFYHCSNDDEDNCADNPCSCSQSHCCTRWSAMGVMSLFLPCLWCYLPAKGCLKLCQGCYDRVNRPGCRCKNSNTVCCKVPTVPPRNFEKPT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1709-Ab Anti-SPY2/ SPRY2/ IGAN3 monoclonal antibody
    Target Antigen GM-Tg-g-MP1709-Ag SPRY2 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP1709 sprouty homolog 2 (Drosophila) (SPRY2) protein & antibody
    ORF Viral Vector pGMLP000306 Human SPRY2 Lentivirus plasmid
    ORF Viral Vector pGMLP005719 Human SPRY2 Lentivirus plasmid
    ORF Viral Vector pGMAD000520 Human SPRY2 Adenovirus plasmid
    ORF Viral Vector vGMLP000306 Human SPRY2 Lentivirus particle
    ORF Viral Vector vGMLP005719 Human SPRY2 Lentivirus particle
    ORF Viral Vector vGMAD000520 Human SPRY2 Adenovirus particle


    Target information

    Target ID GM-MP1709
    Target Name SPRY2
    Gene Group Identifier
    （Target Gene ID in Homo species)         		10253
    Gene ID 100050086 (Equus caballus), 101088453 (Felis catus), 10253 (Homo sapiens), 24064 (Mus musculus)
    306141 (Rattus norvegicus), 485504 (Canis lupus familiaris), 539090 (Bos taurus), 702103 (Macaca mulatta)
    Gene Symbols & Synonyms SPRY2,Spry2,IGAN3,hSPRY2,sprouty2
    Target Alternative Names IGAN3,Protein sprouty homolog 2,SPRY2,Spry-2,Spry2,hSPRY2,sprouty2
    Uniprot Accession O43597,Q08E39,Q9QXV8
    Additional SwissProt Accessions: O43597,Q9QXV8,Q08E39
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSECAG00000002250, ENSG00000136158, ENSMUSG00000022114, ENSCAFG00845028431, ENSBTAG00000001774, ENSMMUG00000018292
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.