Human CHMP4B/C20orf178/CHMP4A ORF/cDNA clone-Lentivirus plasmid (NM_176812)

Cat. No.: pGMLP000414
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CHMP4B/C20orf178/CHMP4A Lentiviral expression plasmid for CHMP4B lentivirus packaging, CHMP4B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CHMP4B/C20orf178 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $468.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000414
Gene Name CHMP4B
Accession Number NM_176812
Gene ID 128866
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 675 bp
Gene Alias C20orf178,CHMP4A,CTPP3,CTRCT31,dJ553F4.4,Shax1,SNF7,SNF7-2,Vps32-2,VPS32B
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCGGTGTTCGGGAAGCTGTTCGGGGCTGGAGGGGGTAAGGCCGGCAAGGGCGGCCCGACCCCCCAGGAGGCCATCCAGCGGCTGCGGGACACGGAAGAGATGTTAAGCAAGAAACAGGAGTTCCTGGAGAAGAAAATCGAGCAGGAGCTGACGGCCGCCAAGAAGCACGGCACCAAAAACAAGCGCGCGGCCCTCCAGGCACTGAAGCGTAAGAAGAGGTATGAGAAGCAGCTGGCGCAGATCGACGGCACATTATCAACCATCGAGTTCCAGCGGGAGGCCCTGGAGAATGCCAACACCAACACCGAGGTGCTCAAGAACATGGGCTATGCCGCCAAGGCCATGAAGGCGGCCCATGACAACATGGACATCGATAAAGTTGATGAGTTAATGCAGGACATTGCTGACCAGCAAGAACTTGCAGAGGAGATTTCAACAGCAATTTCGAAACCTGTAGGGTTTGGAGAAGAGTTTGACGAGGATGAGCTCATGGCGGAATTAGAAGAACTAGAACAGGAGGAACTAGACAAGAATTTGCTGGAAATCAGTGGACCCGAAACAGTCCCTCTACCAAATGTTCCCTCTATAGCCCTACCATCAAAACCCGCCAAGAAGAAAGAAGAGGAGGACGACGACATGAAGGAATTGGAGAACTGGGCTGGATCCATGTAA
ORF Protein Sequence MSVFGKLFGAGGGKAGKGGPTPQEAIQRLRDTEEMLSKKQEFLEKKIEQELTAAKKHGTKNKRAALQALKRKKRYEKQLAQIDGTLSTIEFQREALENANTNTEVLKNMGYAAKAMKAAHDNMDIDKVDELMQDIADQQELAEEISTAISKPVGFGEEFDEDELMAELEELEQEELDKNLLEISGPETVPLPNVPSIALPSKPAKKKEEEDDDMKELENWAGSM

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T47731-Ab Anti-CHMP4B monoclonal antibody
    Target Antigen GM-Tg-g-T47731-Ag CHMP4B protein
    ORF Viral Vector pGMLP000414 Human CHMP4B Lentivirus plasmid
    ORF Viral Vector vGMLP000414 Human CHMP4B Lentivirus particle


    Target information

    Target ID GM-T47731
    Target Name CHMP4B
    Gene Group Identifier
    （Target Gene ID in Homo species)         		128866
    Gene ID 100069227 (Equus caballus), 100359642 (Rattus norvegicus), 101097964 (Felis catus), 128866 (Homo sapiens)
    485842 (Canis lupus familiaris), 616164 (Bos taurus), 709004 (Macaca mulatta), 75608 (Mus musculus)
    Gene Symbols & Synonyms CHMP4B,Chmp4b,RGD1309846,RGD1565889,SNF7,CTPP3,Shax1,CHMP4A,SNF7-2,VPS32B,CTRCT31,Vps32-2,C20orf178,dJ553F4.4,Snf7-2,2010012F05Rik
    Target Alternative Names 2010012F05Rik,C20orf178,CHMP4A,CHMP4B,CTPP3,CTRCT31,Charged multivesicular body protein 4b,Chmp4b,Chromatin-modifying protein 4b (CHMP4b),RGD1309846,RGD1565889,SNF7,SNF7 homolog associated with Alix 1,SNF7-2,SNF7-2 (hSnf7-2),Shax1,Snf7-2,VPS32B,Vacuolar protein sorting-associated protein 32-2 (Vps32-2,Vps32-2,dJ553F4.4,hVps32-2)
    Uniprot Accession Q9D8B3,Q9H444
    Additional SwissProt Accessions: Q9H444,Q9D8B3
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000008311, ENSG00000101421, ENSCAFG00845025558, ENSBTAG00000013387, ENSMMUG00000008084, ENSMUSG00000038467
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.