Human BCL2L1/Bcl-X/BCL-XL/S ORF/cDNA clone-Lentivirus plasmid (NM_138578)

Cat. No.: pGMLP000494
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human BCL2L1/Bcl-X/BCL-XL/S Lentiviral expression plasmid for BCL2L1 lentivirus packaging, BCL2L1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to Bcl-XL/Bcl-xL/BCL2L1/BCL-xL/BCL2L1/Bcl-X products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $475.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000494
Gene Name BCL2L1
Accession Number NM_138578
Gene ID 598
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 702 bp
Gene Alias Bcl-X,BCL-XL/S,BCL2L,BCLX,PPP1R52
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTCAGAGCAACCGGGAGCTGGTGGTTGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCTGGAGTCAGTTTAGTGATGTGGAAGAGAACAGGACTGAGGCCCCAGAAGGGACTGAATCGGAGATGGAGACCCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCAGACAGCCCCGCGGTGAATGGAGCCACTGGCCACAGCAGCAGTTTGGATGCCCGGGAGGTGATCCCCATGGCAGCAGTAAAGCAAGCGCTGAGGGAGGCAGGCGACGAGTTTGAACTGCGGTACCGGCGGGCATTCAGTGACCTGACATCCCAGCTCCACATCACCCCAGGGACAGCATATCAGAGCTTTGAACAGGTAGTGAATGAACTCTTCCGGGATGGGGTAAACTGGGGTCGCATTGTGGCCTTTTTCTCCTTCGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATGCAGGTATTGGTGAGTCGGATCGCAGCTTGGATGGCCACTTACCTGAATGACCACCTAGAGCCTTGGATCCAGGAGAACGGCGGCTGGGATACTTTTGTGGAACTCTATGGGAACAATGCAGCAGCCGAGAGCCGAAAGGGCCAGGAACGCTTCAACCGCTGGTTCCTGACGGGCATGACTGTGGCCGGCGTGGTTCTGCTGGGCTCACTCTTCAGTCGGAAATGA
ORF Protein Sequence MSQSNRELVVDFLSYKLSQKGYSWSQFSDVEENRTEAPEGTESEMETPSAINGNPSWHLADSPAVNGATGHSSSLDAREVIPMAAVKQALREAGDEFELRYRRAFSDLTSQLHITPGTAYQSFEQVVNELFRDGVNWGRIVAFFSFGGALCVESVDKEMQVLVSRIAAWMATYLNDHLEPWIQENGGWDTFVELYGNNAAAESRKGQERFNRWFLTGMTVAGVVLLGSLFSRK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0048-Ab Anti-BCL-xL monoclonal antibody
    Target Antigen GM-Tg-g-IP0048-Ag BCL-xL/BCL2L1 protein
    ORF Viral Vector pGMLP000494 Human BCL2L1 Lentivirus plasmid
    ORF Viral Vector pGMLP005610 Human BCL2L1 Lentivirus plasmid
    ORF Viral Vector pGMLP005822 Human BCL2L1 Lentivirus plasmid
    ORF Viral Vector pGMAP000056 Human BCL2L1 Adenovirus plasmid
    ORF Viral Vector pGMPC001115 Human BCL2L1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000494 Human BCL2L1 Lentivirus particle
    ORF Viral Vector vGMLP005610 Human BCL2L1 Lentivirus particle
    ORF Viral Vector vGMLP005822 Human BCL2L1 Lentivirus particle
    ORF Viral Vector vGMAP000056 Human BCL2L1 Adenovirus particle


    Target information

    Target ID GM-IP0048
    Target Name Bcl-XL/Bcl-xL/BCL2L1/BCL-xL
    Gene Group Identifier
    （Target Gene ID in Homo species)         		598
    Gene ID 100053597 (Equus caballus), 12048 (Mus musculus), 24888 (Rattus norvegicus), 282152 (Bos taurus)
    403618 (Canis lupus familiaris), 493701 (Felis catus), 598 (Homo sapiens), 713035 (Macaca mulatta)
    Gene Symbols & Synonyms BCL2L1,Bcl2l1,BclX,Bcl2l,bcl-x,Bcl-XL,Bcl(X)L,bcl2-L-1,Bclx,bcl-X,Bcl-xl,BCLX,Bcl-xL,BCL-XL,bcl-xl,BCL2L,Bcl-X,PPP1R52,BCL-XL/S
    Target Alternative Names Apoptosis regulator Bcl-X,BCL-XL,BCL-XL/S,BCL-xL,BCL2L,BCL2L1,BCLX,Bcl(X)L,Bcl-2-like protein 1,Bcl-X,Bcl-XL,Bcl-xL,Bcl-xl,Bcl2-L-1,Bcl2l,Bcl2l1,BclX,Bclx,PPP1R52,bcl-X,bcl-x,bcl-xl,bcl2-L-1
    Uniprot Accession P53563,Q07817,Q64373
    Additional SwissProt Accessions: Q64373,P53563,Q07817
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG EGFR tyrosine kinase inhibitor resistance, Ras signaling pathway, NF-kappa B signaling pathway, p53 signaling pathway, PI3K-Akt signaling pathway, Apoptosis, Apoptosis - multiple species, NOD-like receptor signaling pathway, JAK-STAT signaling pathway, Toxoplasmosis, Measles, Human T-cell leukemia virus 1 infection, Pathways in cancer, Pancreatic cancer, Chronic myeloid leukemia, Small cell lung cancer, Hepatocellular carcinoma, Lipid and atherosclerosis
    Gene Ensembl ENSECAG00000017223, ENSMUSG00000007659, ENSBTAG00000006526, ENSCAFG00845018778, ENSG00000171552, ENSMMUG00000005985
    Target Classification Pathway, Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.