Human BCL2L1/Bcl-X/BCL-XL/S ORF/cDNA clone-Lentivirus plasmid (NM_138578)
Cat. No.: pGMLP000494
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human BCL2L1/Bcl-X/BCL-XL/S Lentiviral expression plasmid for BCL2L1 lentivirus packaging, BCL2L1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
Bcl-XL/Bcl-xL/BCL2L1/BCL-xL/BCL2L1/Bcl-X products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLP000494 |
| Gene Name | BCL2L1 |
| Accession Number | NM_138578 |
| Gene ID | 598 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 702 bp |
| Gene Alias | Bcl-X,BCL-XL/S,BCL2L,BCLX,PPP1R52 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGTCTCAGAGCAACCGGGAGCTGGTGGTTGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCTGGAGTCAGTTTAGTGATGTGGAAGAGAACAGGACTGAGGCCCCAGAAGGGACTGAATCGGAGATGGAGACCCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCAGACAGCCCCGCGGTGAATGGAGCCACTGGCCACAGCAGCAGTTTGGATGCCCGGGAGGTGATCCCCATGGCAGCAGTAAAGCAAGCGCTGAGGGAGGCAGGCGACGAGTTTGAACTGCGGTACCGGCGGGCATTCAGTGACCTGACATCCCAGCTCCACATCACCCCAGGGACAGCATATCAGAGCTTTGAACAGGTAGTGAATGAACTCTTCCGGGATGGGGTAAACTGGGGTCGCATTGTGGCCTTTTTCTCCTTCGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATGCAGGTATTGGTGAGTCGGATCGCAGCTTGGATGGCCACTTACCTGAATGACCACCTAGAGCCTTGGATCCAGGAGAACGGCGGCTGGGATACTTTTGTGGAACTCTATGGGAACAATGCAGCAGCCGAGAGCCGAAAGGGCCAGGAACGCTTCAACCGCTGGTTCCTGACGGGCATGACTGTGGCCGGCGTGGTTCTGCTGGGCTCACTCTTCAGTCGGAAATGA |
| ORF Protein Sequence | MSQSNRELVVDFLSYKLSQKGYSWSQFSDVEENRTEAPEGTESEMETPSAINGNPSWHLADSPAVNGATGHSSSLDAREVIPMAAVKQALREAGDEFELRYRRAFSDLTSQLHITPGTAYQSFEQVVNELFRDGVNWGRIVAFFSFGGALCVESVDKEMQVLVSRIAAWMATYLNDHLEPWIQENGGWDTFVELYGNNAAAESRKGQERFNRWFLTGMTVAGVVLLGSLFSRK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP0048-Ab | Anti-BCL-xL monoclonal antibody |
| Target Antigen | GM-Tg-g-IP0048-Ag | BCL-xL/BCL2L1 protein |
| ORF Viral Vector | pGMLP000494 | Human BCL2L1 Lentivirus plasmid |
| ORF Viral Vector | pGMLP005610 | Human BCL2L1 Lentivirus plasmid |
| ORF Viral Vector | pGMLP005822 | Human BCL2L1 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000056 | Human BCL2L1 Adenovirus plasmid |
| ORF Viral Vector | pGMPC001115 | Human BCL2L1 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP000494 | Human BCL2L1 Lentivirus particle |
| ORF Viral Vector | vGMLP005610 | Human BCL2L1 Lentivirus particle |
| ORF Viral Vector | vGMLP005822 | Human BCL2L1 Lentivirus particle |
| ORF Viral Vector | vGMAP000056 | Human BCL2L1 Adenovirus particle |
Target information
| Target ID | GM-IP0048 |
| Target Name | Bcl-XL/Bcl-xL/BCL2L1/BCL-xL |
|
Gene Group Identifier (Target Gene ID in Homo species) |
598 |
| Gene ID |
100053597 (Equus caballus), 12048 (Mus musculus), 24888 (Rattus norvegicus), 282152 (Bos taurus) 403618 (Canis lupus familiaris), 493701 (Felis catus), 598 (Homo sapiens), 713035 (Macaca mulatta) |
| Gene Symbols & Synonyms | BCL2L1,Bcl2l1,BclX,Bcl2l,bcl-x,Bcl-XL,Bcl(X)L,bcl2-L-1,Bclx,bcl-X,Bcl-xl,BCLX,Bcl-xL,BCL-XL,bcl-xl,BCL2L,Bcl-X,PPP1R52,BCL-XL/S |
| Target Alternative Names | Apoptosis regulator Bcl-X,BCL-XL,BCL-XL/S,BCL-xL,BCL2L,BCL2L1,BCLX,Bcl(X)L,Bcl-2-like protein 1,Bcl-X,Bcl-XL,Bcl-xL,Bcl-xl,Bcl2-L-1,Bcl2l,Bcl2l1,BclX,Bclx,PPP1R52,bcl-X,bcl-x,bcl-xl,bcl2-L-1 |
| Uniprot Accession |
P53563,Q07817,Q64373
Additional SwissProt Accessions: Q64373,P53563,Q07817 |
| Uniprot Entry Name | |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | cancer |
| Disease from KEGG | EGFR tyrosine kinase inhibitor resistance, Ras signaling pathway, NF-kappa B signaling pathway, p53 signaling pathway, PI3K-Akt signaling pathway, Apoptosis, Apoptosis - multiple species, NOD-like receptor signaling pathway, JAK-STAT signaling pathway, Toxoplasmosis, Measles, Human T-cell leukemia virus 1 infection, Pathways in cancer, Pancreatic cancer, Chronic myeloid leukemia, Small cell lung cancer, Hepatocellular carcinoma, Lipid and atherosclerosis |
| Gene Ensembl | ENSECAG00000017223, ENSMUSG00000007659, ENSBTAG00000006526, ENSCAFG00845018778, ENSG00000171552, ENSMMUG00000005985 |
| Target Classification | Pathway, Tumor-associated antigen (TAA) |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


