Human PMP22/CIDP/CMT1A ORF/cDNA clone-Lentivirus plasmid (NM_000304)

Cat. No.: pGMLP000512
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PMP22/CIDP/CMT1A Lentiviral expression plasmid for PMP22 lentivirus packaging, PMP22 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PMP22/CIDP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000512
Gene Name PMP22
Accession Number NM_000304
Gene ID 5376
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 483 bp
Gene Alias CIDP,CMT1A,CMT1E,DSS,GAS-3,GAS3,HMSNIA,HNPP,Sp110
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTCCTCCTGTTGCTGAGTATCATCGTCCTCCACGTCGCGGTGCTGGTGCTGCTGTTCGTCTCCACGATCGTCAGCCAATGGATCGTGGGCAATGGACACGCAACTGATCTCTGGCAGAACTGTAGCACCTCTTCCTCAGGAAATGTCCACCACTGTTTCTCATCATCACCAAACGAATGGCTGCAGTCTGTCCAGGCCACCATGATCCTGTCGATCATCTTCAGCATTCTGTCTCTGTTCCTGTTCTTCTGCCAACTCTTCACCCTCACCAAGGGGGGCAGGTTTTACATCACTGGAATCTTCCAAATTCTTGCTGGTCTGTGCGTGATGAGTGCTGCGGCCATCTACACGGTGAGGCACCCGGAGTGGCATCTCAACTCGGATTACTCCTACGGTTTCGCCTACATCCTGGCCTGGGTGGCCTTCCCCCTGGCCCTTCTCAGCGGTGTCATCTATGTGATCTTGCGGAAACGCGAATGA
ORF Protein Sequence MLLLLLSIIVLHVAVLVLLFVSTIVSQWIVGNGHATDLWQNCSTSSSGNVHHCFSSSPNEWLQSVQATMILSIIFSILSLFLFFCQLFTLTKGGRFYITGIFQILAGLCVMSAAAIYTVRHPEWHLNSDYSYGFAYILAWVAFPLALLSGVIYVILRKRE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1395-Ab Anti-PMP22/ CIDP/ CMT1A monoclonal antibody
    Target Antigen GM-Tg-g-MP1395-Ag PMP22 VLP (virus-like particle)
    ORF Viral Vector pGMLP000512 Human PMP22 Lentivirus plasmid
    ORF Viral Vector pGMAP000148 Human PMP22 Adenovirus plasmid
    ORF Viral Vector vGMLP000512 Human PMP22 Lentivirus particle
    ORF Viral Vector vGMAP000148 Human PMP22 Adenovirus particle


    Target information

    Target ID GM-MP1395
    Target Name PMP22
    Gene Group Identifier
    （Target Gene ID in Homo species)         		5376
    Gene ID 100034146 (Equus caballus), 101092215 (Felis catus), 18858 (Mus musculus), 24660 (Rattus norvegicus)
    479509 (Canis lupus familiaris), 534497 (Bos taurus), 5376 (Homo sapiens), 693527 (Macaca mulatta)
    Gene Symbols & Synonyms PMP22,Pmp22,Tr,HNPP,Gas-3,PMP-22,TRE002,trembler,DSS,CIDP,GAS3,CMT1A,CMT1E,GAS-3,Sp110,HMSNIA
    Target Alternative Names CIDP,CMT1A,CMT1E,DSS,GAS-3,GAS3,Gas-3,Growth arrest-specific protein 3 (GAS-3),HMSNIA,HNPP,PMP-22,PMP22,Peripheral myelin protein 22,Pmp22,Sp110,TRE002,Tr,trembler
    Uniprot Accession P16646,P25094,Q01453,Q6WL85,Q9TQZ3
    Additional SwissProt Accessions: Q6WL85,P16646,P25094,Q9TQZ3,Q01453
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSECAG00000025178, ENSMUSG00000018217, ENSCAFG00845004152, ENSBTAG00000019070, ENSG00000109099, ENSMMUG00000002206
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.