Human TFF1/BCEI/D21S21 ORF/cDNA clone-Lentivirus plasmid (NM_003225)

Cat. No.: pGMLP000538
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TFF1/BCEI/D21S21 Lentiviral expression plasmid for TFF1 lentivirus packaging, TFF1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TFF1/BCEI products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000538
Gene Name TFF1
Accession Number NM_003225
Gene ID 7031
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 255 bp
Gene Alias BCEI,D21S21,HP1.A,HPS2,pNR-2,pS2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCACCATGGAGAACAAGGTGATCTGCGCCCTGGTCCTGGTGTCCATGCTGGCCCTCGGCACCCTGGCCGAGGCCCAGACAGAGACGTGTACAGTGGCCCCCCGTGAAAGACAGAATTGTGGTTTTCCTGGTGTCACGCCCTCCCAGTGTGCAAATAAGGGCTGCTGTTTCGACGACACCGTTCGTGGGGTCCCCTGGTGCTTCTATCCTAATACCATCGACGTCCCTCCAGAAGAGGAGTGTGAATTTTAG
ORF Protein Sequence MATMENKVICALVLVSMLALGTLAEAQTETCTVAPRERQNCGFPGVTPSQCANKGCCFDDTVRGVPWCFYPNTIDVPPEEECEF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T38159-Ab Anti-TFF1/ BCEI/ D21S21 functional antibody
    Target Antigen GM-Tg-g-T38159-Ag TFF1 protein
    ORF Viral Vector pGMLP000538 Human TFF1 Lentivirus plasmid
    ORF Viral Vector pGMAP000440 Human TFF1 Adenovirus plasmid
    ORF Viral Vector vGMLP000538 Human TFF1 Lentivirus particle
    ORF Viral Vector vGMAP000440 Human TFF1 Adenovirus particle


    Target information

    Target ID GM-T38159
    Target Name TFF1
    Gene Group Identifier
    （Target Gene ID in Homo species)         		7031
    Gene ID 100170654 (Felis catus), 100301237 (Bos taurus), 100423966 (Macaca mulatta), 100629635 (Equus caballus)
    117270 (Rattus norvegicus), 21784 (Mus musculus), 403491 (Canis lupus familiaris), 7031 (Homo sapiens)
    Gene Symbols & Synonyms TFF1,Tff1,Ps2,PS2,Bcei,pS2,BCEI,HPS2,HP1.A,pNR-2,D21S21
    Target Alternative Names BCEI,Bcei,Breast cancer estrogen-inducible protein,D21S21,HP1.A,HPS2,PNR-2,PS2,Polypeptide P1.A (hP1.A),Protein pS2,Ps2,TFF1,Tff1,Trefoil factor 1,pNR-2,pS2
    Uniprot Accession P04155,Q08423,Q63467,Q863T4
    Additional SwissProt Accessions: Q63467,Q08423,Q863T4,P04155
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSBTAG00000048276, ENSMMUG00000050587, ENSECAG00000018260, ENSMUSG00000024032, ENSCAFG00845030496, ENSG00000160182
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.