Human CCL11/SCYA11 ORF/cDNA clone-Lentivirus plasmid (NM_002986)

Cat. No.: pGMLP000540
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CCL11/SCYA11 Lentiviral expression plasmid for CCL11 lentivirus packaging, CCL11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CCL11/Eotaxin/CCL11/SCYA11 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000540
Gene Name CCL11
Accession Number NM_002986
Gene ID 6356
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 294 bp
Gene Alias SCYA11
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGGTCTCCGCAGCACTTCTGTGGCTGCTGCTCATAGCAGCTGCCTTCAGCCCCCAGGGGCTCGCTGGGCCAGCTTCTGTCCCAACCACCTGCTGCTTTAACCTGGCCAATAGGAAGATACCCCTTCAGCGACTAGAGAGCTACAGGAGAATCACCAGTGGCAAATGTCCCCAGAAAGCTGTGATCTTCAAGACCAAACTGGCCAAGGATATCTGTGCCGACCCCAAGAAGAAGTGGGTGCAGGATTCCATGAAGTATCTGGACCAAAAATCTCCAACTCCAAAGCCATAA
ORF Protein Sequence MKVSAALLWLLLIAAAFSPQGLAGPASVPTTCCFNLANRKIPLQRLESYRRITSGKCPQKAVIFKTKLAKDICADPKKKWVQDSMKYLDQKSPTPKP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-755 Pre-Made Bertilimumab Biosimilar, Whole Mab, Anti-Ccl11 Antibody: Anti-SCYA11 therapeutic antibody
    Target Antibody GM-Tg-g-T16888-Ab Anti-CCL11/ SCYA11 functional antibody
    Target Antigen GM-Tg-g-T16888-Ag CCL11 protein
    Cytokine cks-Tg-g-GM-T16888 chemokine (C-C motif) ligand 11 (CCL11) protein & antibody
    ORF Viral Vector pGMLP000540 Human CCL11 Lentivirus plasmid
    ORF Viral Vector pGMAP000414 Human CCL11 Adenovirus plasmid
    ORF Viral Vector vGMLP000540 Human CCL11 Lentivirus particle
    ORF Viral Vector vGMAP000414 Human CCL11 Adenovirus particle


    Target information

    Target ID GM-T16888
    Target Name CCL11/Eotaxin
    Gene Group Identifier
    （Target Gene ID in Homo species)         		6356
    Gene ID 574218 (Macaca mulatta), 6356 (Homo sapiens)
    Gene Symbols & Synonyms CCL11,SCYA11,Eotaxin
    Target Alternative Names C-C motif chemokine 11,CCL11,Eosinophil chemotactic protein,Eotaxin,SCYA11,Small-inducible cytokine A11
    Uniprot Accession P51671,Q8MIT7
    Additional SwissProt Accessions: Q8MIT7,P51671
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Ovary Cancer
    Disease from KEGG Cytokine-cytokine receptor interaction, Viral protein interaction with cytokine and cytokine receptor, Chemokine signaling pathway, IL-17 signaling pathway, Asthma
    Gene Ensembl ENSMMUG00000064793, ENSG00000172156
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.