Human IL2/IL-2/lymphokine ORF/cDNA clone-Lentivirus plasmid (NM_000586)

Cat. No.: pGMLP000542
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL2/IL-2/lymphokine Lentiviral expression plasmid for IL2 lentivirus packaging, IL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to IL-2/IL2/IL2/IL-2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000542
Gene Name IL2
Accession Number NM_000586
Gene ID 3558
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 462 bp
Gene Alias IL-2,lymphokine,TCGF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACAAACAGTGCACCTACTTCAAGTTCTACAAAGAAAACACAGCTACAACTGGAGCATTTACTGCTGGATTTACAGATGATTTTGAATGGAATTAATAATTACAAGAATCCCAAACTCACCAGGATGCTCACATTTAAGTTTTACATGCCCAAGAAGGCCACAGAACTGAAACATCTTCAGTGTCTAGAAGAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGCAAAAACTTTCACTTAAGACCCAGGGACTTAATCAGCAATATCAACGTAATAGTTCTGGAACTAAAGGGATCTGAAACAACATTCATGTGTGAATATGCTGATGAGACAGCAACCATTGTAGAATTTCTGAACAGATGGATTACCTTTTGTCAAAGCATCATCTCAACACTGACTTGA
ORF Protein Sequence MYRMQLLSCIALSLALVTNSAPTSSSTKKTQLQLEHLLLDLQMILNGINNYKNPKLTRMLTFKFYMPKKATELKHLQCLEEELKPLEEVLNLAQSKNFHLRPRDLISNINVIVLELKGSETTFMCEYADETATIVEFLNRWITFCQSIISTLT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-811 Pre-Made Efavaleukin Alfa Biosimilar, Fusion Protein targeting IL2 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting IL-2/TCGF/lymphokine
    Target Antibody GM-Tg-g-T61698-Ab Anti-IL2/ IL-2/ TCGF functional antibody
    Target Antigen GM-Tg-g-T61698-Ag IL2 protein
    ORF Viral Vector pGMLP000542 Human IL2 Lentivirus plasmid
    ORF Viral Vector pGMAP000406 Human IL2 Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-005 Human IL2 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-088 Human IL2 Adenovirus plasmid
    ORF Viral Vector pGMPC004771 Human IL2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000542 Human IL2 Lentivirus particle
    ORF Viral Vector vGMAP000406 Human IL2 Adenovirus particle
    ORF Viral Vector vGMLP-IL-005 Human IL2 Lentivirus particle
    ORF Viral Vector vGMAP-IL-088 Human IL2 Adenovirus particle


    Target information

    Target ID GM-T61698
    Target Name IL-2/IL2
    Gene Group Identifier
    （Target Gene ID in Homo species)         		3558
    Gene ID 100034204 (Equus caballus), 116562 (Rattus norvegicus), 16183 (Mus musculus), 280822 (Bos taurus)
    3558 (Homo sapiens), 403989 (Canis lupus familiaris), 708017 (Macaca mulatta), 751114 (Felis catus)
    Gene Symbols & Synonyms IL2,Il2,IL-2,TCGF,Il-2,lymphokine
    Target Alternative Names IL-2,IL2,Il-2,Il2,Interleukin-2,T-cell growth factor (TCGF),TCGF,lymphokine
    Uniprot Accession P04351,P05016,P17108,P37997,P60568,P68291,Q07885,Q29416
    Additional SwissProt Accessions: P37997,P17108,P04351,P05016,P60568,Q29416,P68291,Q07885
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease cancer, Chronic Kidney Disease
    Disease from KEGG Cytokine-cytokine receptor interaction, Viral protein interaction with cytokine and cytokine receptor, PI3K-Akt signaling pathway, C-type lectin receptor signaling pathway, JAK-STAT signaling pathway, Th1 and Th2 cell differentiation, Th17 cell differentiation, T cell receptor signaling pathway, Intestinal immune network for IgA production, Type I diabetes mellitus, Yersinia infection, Chagas disease, Measles, Human T-cell leukemia virus 1 infection, Pathways in cancer, Autoimmune thyroid disease, Inflammatory bowel disease, Allograft rejection, Graft-versus-host disease
    Gene Ensembl ENSECAG00000015616, ENSMUSG00000027720, ENSBTAG00000020883, ENSG00000109471, ENSCAFG00845020168, ENSMMUG00000021093
    Target Classification Cytokine Receptor, Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.