Human IFNB1/IFB/IFF ORF/cDNA clone-Lentivirus plasmid (NM_002176)

Cat. No.: pGMLP000557
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IFNB1/IFB/IFF Lentiviral expression plasmid for IFNB1 lentivirus packaging, IFNB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to IFN beta/IFN beta1/IFNB1/IFNB1/IFB products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $441
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000557
Gene Name IFNB1
Accession Number NM_002176
Gene ID 3456
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 564 bp
Gene Alias IFB,IFF,IFN-beta,IFNB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCAACAAGTGTCTCCTCCAAATTGCTCTCCTGTTGTGCTTCTCCACTACAGCTCTTTCCATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAATTTTCAGTGTCAGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGCCTCAAGGACAGGATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGCAGTTCCAGAAGGAGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACATCTTTGCTATTTTCAGACAAGATTCATCTAGCACTGGCTGGAATGAGACTATTGTTGAGAACCTCCTGGCTAATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGGAAGAAAAACTGGAGAAAGAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACCTGAAAAGATATTATGGGAGGATTCTGCATTACCTGAAGGCCAAGGAGTACAGTCACTGTGCCTGGACCATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTCATTAACAGACTTACAGGTTACCTCCGAAACTGA
ORF Protein Sequence MTNKCLLQIALLLCFSTTALSMSYNLLGFLQRSSNFQCQKLLWQLNGRLEYCLKDRMNFDIPEEIKQLQQFQKEDAALTIYEMLQNIFAIFRQDSSSTGWNETIVENLLANVYHQINHLKTVLEEKLEKEDFTRGKLMSSLHLKRYYGRILHYLKAKEYSHCAWTIVRVEILRNFYFINRLTGYLRN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T02808-Ab Anti-IFNB/ IFNB1/ IFB functional antibody
    Target Antigen GM-Tg-g-T02808-Ag IFNB1 protein
    Cytokine cks-Tg-g-GM-T02808 interferon, beta 1, fibroblast (IFNB1) protein & antibody
    ORF Viral Vector pGMLP000557 Human IFNB1 Lentivirus plasmid
    ORF Viral Vector pGMAP000549 Human IFNB1 Adenovirus plasmid
    ORF Viral Vector vGMLP000557 Human IFNB1 Lentivirus particle
    ORF Viral Vector vGMAP000549 Human IFNB1 Adenovirus particle


    Target information

    Target ID GM-T02808
    Target Name IFN beta/IFN beta1/IFNB1
    Gene Group Identifier
    （Target Gene ID in Homo species)         		3456
    Gene ID 100052545 (Equus caballus), 15977 (Mus musculus), 24481 (Rattus norvegicus), 3456 (Homo sapiens)
    481558 (Canis lupus familiaris), 493849 (Felis catus), 711414 (Macaca mulatta)
    Gene Symbols & Synonyms IFNB1,Ifnb1,IFNB,IF1DA1,Ifb,If1da1,IFN-beta,Ifnb,IFB,IFF
    Target Alternative Names Fibroblast interferon,IF1DA1,IFB,IFF,IFN beta,IFN beta1,IFN-beta,IFNB,IFNB1,If1da1,Ifb,Ifnb,Ifnb1,Interferon beta
    Uniprot Accession P01574,P01575,P05012,P70499,Q9N2J0
    Additional SwissProt Accessions: P05012,P01575,P70499,P01574,Q9N2J0
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease
    Disease from KEGG Cytokine-cytokine receptor interaction, PI3K-Akt signaling pathway, Osteoclast differentiation, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, JAK-STAT signaling pathway, Natural killer cell mediated cytotoxicity, TNF signaling pathway, Alcoholic liver disease, Yersinia infection, Chagas disease, Tuberculosis, Hepatitis C, Hepatitis B, Measles, Human cytomegalovirus infection, Influenza A, Human papillomavirus infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Lipid and atherosclerosis
    Gene Ensembl ENSMUSG00000048806, ENSG00000171855, ENSCAFG00845016293, ENSMMUG00000019067
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.