Human LRAT/LCA14 ORF/cDNA clone-Lentivirus plasmid (NM_004744)

Cat. No.: pGMLP000561
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LRAT/LCA14 Lentiviral expression plasmid for LRAT lentivirus packaging, LRAT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to LRAT/LCA14 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $473.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000561
Gene Name LRAT
Accession Number NM_004744
Gene ID 9227
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 693 bp
Gene Alias LCA14
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGAACCCCATGCTGGAGGTGGTGTCTTTACTACTGGAGAAGCTGCTCCTCATCTCCAACTTCACGCTCTTTAGTTCGGGCGCCGCGGGCGAAGACAAAGGGAGGAACAGTTTTTATGAAACCAGCTCTTTCCACCGAGGCGACGTGCTGGAGGTGCCCCGGACCCACCTGACCCACTATGGCATCTACCTAGGAGACAACCGTGTTGCCCACATGATGCCCGACATCCTGTTGGCCCTGACAGACGACATGGGGCGCACGCAGAAGGTGGTCTCCAACAAGCGTCTCATCCTGGGCGTTATTGTCAAAGTGGCCAGCATCCGCGTGGACACAGTGGAGGACTTCGCCTACGGAGCTAACATCCTGGTCAATCACCTGGACGAGTCCCTCCAGAAAAAGGCACTGCTCAACGAGGAGGTGGCGCGGAGGGCTGAAAAGCTGCTGGGCTTTACCCCCTACAGCCTGCTGTGGAACAACTGCGAGCACTTCGTGACCTACTGCAGATATGGCACCCCGATCAGTCCCCAGTCCGACAAGTTTTGTGAGACTGTGAAGATAATTATTCGTGATCAGAGAAGTGTTCTTGCTTCAGCAGTCTTGGGATTGGCGTCTATAGTCTGTACGGGCTTGGTATCATACACTACCCTTCCTGCAATTTTTATTCCATTCTTCCTATGGATGGCTGGCTAA
ORF Protein Sequence MKNPMLEVVSLLLEKLLLISNFTLFSSGAAGEDKGRNSFYETSSFHRGDVLEVPRTHLTHYGIYLGDNRVAHMMPDILLALTDDMGRTQKVVSNKRLILGVIVKVASIRVDTVEDFAYGANILVNHLDESLQKKALLNEEVARRAEKLLGFTPYSLLWNNCEHFVTYCRYGTPISPQSDKFCETVKIIIRDQRSVLASAVLGLASIVCTGLVSYTTLPAIFIPFFLWMAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1105-Ab Anti-LRAT monoclonal antibody
    Target Antigen GM-Tg-g-IP1105-Ag LRAT protein
    ORF Viral Vector pGMLP000561 Human LRAT Lentivirus plasmid
    ORF Viral Vector pGMAAV001537 Human LRAT Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV001538 Human LRAT Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMLP000561 Human LRAT Lentivirus particle
    ORF Viral Vector vGMAAV001537 Human LRAT Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV001538 Human LRAT Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-IP1105
    Target Name LRAT
    Gene Group Identifier
    (Target Gene ID in Homo species)
    9227
    Gene ID 100069704 (Equus caballus), 101092432 (Felis catus), 281285 (Bos taurus), 482660 (Canis lupus familiaris)
    64047 (Rattus norvegicus), 698871 (Macaca mulatta), 79235 (Mus musculus), 9227 (Homo sapiens)
    Gene Symbols & Synonyms LRAT,Lrat,1300010A18Rik,LCA14
    Target Alternative Names 1300010A18Rik,LCA14,LRAT,Lecithin retinol acyltransferase,Lrat,Phosphatidylcholine--retinol O-acyltransferase
    Uniprot Accession O95237,Q9BGL2,Q9JI60,Q9JI61
    Additional SwissProt Accessions: Q9BGL2,Q9JI61,Q9JI60,O95237
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG Metabolic pathways, Vitamin digestion and absorption, Retinol metabolism
    Gene Ensembl ENSECAG00000007711, ENSBTAG00000017167, ENSCAFG00845010027, ENSMMUG00000052999, ENSMUSG00000028003, ENSG00000121207
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.