Human HRCT1/LGLL338/PRO537 ORF/cDNA clone-Lentivirus plasmid (NM_001039792)

Cat. No.: pGMLP000961
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HRCT1/LGLL338/PRO537 Lentiviral expression plasmid for HRCT1 lentivirus packaging, HRCT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to HRCT1/LGLL338 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000961
Gene Name HRCT1
Accession Number NM_001039792
Gene ID 646962
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 348 bp
Gene Alias LGLL338,PRO537,UNQ338
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGGGCCTCCTGGGGAGCACAGCCCTCGTGGGATGGATCACAGGTGCTGCTGTGGCGGTCCTGCTGCTGCTGCTGCTGCTGGCCACCTGCCTTTTCCACGGACGGCAGGACTGTGACGTGGAGAGGAACCGTACAGCTGCAGGGGGAAACCGAGTCCGCCGGGCCCAGCCTTGGCCCTTCCGGCGGCGGGGCCACCTGGGAATCTTTCACCATCACCGTCATCCTGGCCACGTATCTCATGTGCCGAATGTGGGCCTCCACCACCACCACCACCCCCGCCACACCCCTCACCACCTCCACCACCACCACCACCCCCACCGCCACCATCCCCGCCACGCTCGCTGA
ORF Protein Sequence MLGLLGSTALVGWITGAAVAVLLLLLLLATCLFHGRQDCDVERNRTAAGGNRVRRAQPWPFRRRGHLGIFHHHRHPGHVSHVPNVGLHHHHHPRHTPHHLHHHHHPHRHHPRHAR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0980-Ab Anti-HRCT1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0980-Ag HRCT1 protein
    ORF Viral Vector pGMLP000961 Human HRCT1 Lentivirus plasmid
    ORF Viral Vector vGMLP000961 Human HRCT1 Lentivirus particle


    Target information

    Target ID GM-IP0980
    Target Name HRCT1
    Gene Group Identifier
    （Target Gene ID in Homo species)         		646962
    Gene ID 100039781 (Mus musculus), 100359865 (Rattus norvegicus), 100426328 (Macaca mulatta), 100683174 (Canis lupus familiaris)
    100847747 (Bos taurus), 101088526 (Felis catus), 646962 (Homo sapiens)
    Gene Symbols & Synonyms Hrct1,HRCT1,3830408D24Rik,PRO537,UNQ338,LGLL338
    Target Alternative Names 3830408D24Rik,HRCT1,Histidine-rich carboxyl terminus protein 1,Hrct1,LGLL338,PRO537,UNQ338
    Uniprot Accession Q6UXD1,Q9D6B9
    Additional SwissProt Accessions: Q9D6B9,Q6UXD1
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSMUSG00000071001, ENSMMUG00000016342, ENSBTAG00000055183, ENSG00000196196
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.