Human GID8/C20orf11/TWA1 ORF/cDNA clone-Lentivirus plasmid (NM_017896)

Cat. No.: pGMLP003466
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GID8/C20orf11/TWA1 Lentiviral expression plasmid for GID8 lentivirus packaging, GID8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to GID8/C20orf11 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $471.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003466
Gene Name GID8
Accession Number NM_017896
Gene ID 54994
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 687 bp
Gene Alias C20orf11,TWA1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGTTATGCAGAAAAACCCGATGAAATCACGAAAGATGAGTGGATGGAAAAGCTCAATAACTTGCATGTCCAGAGAGCAGACATGAACCGCCTCATCATGAACTACCTGGTCACAGAGGGCTTTAAGGAAGCAGCGGAGAAGTTTCGAATGGAATCTGGAATCGAACCTAGTGTGGATCTGGAAACACTTGATGAACGAATCAAGATCCGGGAGATGATACTGAAAGGTCAGATTCAGGAGGCCATCGCCTTGATCAACAGCCTCCACCCAGAGCTCTTGGACACAAACCGGTATCTTTACTTCCATTTGCAGCAACAGCATTTGATCGAGCTGATCCGCCAGCGGGAGACAGAGGCGGCGCTGGAGTTTGCACAGACTCAGCTGGCGGAGCAGGGCGAGGAGAGCCGAGAGTGCCTCACAGAGATGGAGCGTACCCTGGCACTGCTGGCCTTTGACAGTCCCGAGGAGTCGCCCTTCGGAGACCTCCTCCACACCATGCAGAGGCAGAAGGTGTGGAGTGAAGTTAACCAAGCTGTGCTAGATTATGAAAATCGCGAGTCAACACCCAAACTGGCAAAATTACTGAAACTACTACTTTGGGCTCAGAACGAGCTGGACCAGAAGAAAGTAAAATATCCCAAAATGACAGACCTCAGCAAGGGTGTGATTGAGGAGCCCAAGTAG
ORF Protein Sequence MSYAEKPDEITKDEWMEKLNNLHVQRADMNRLIMNYLVTEGFKEAAEKFRMESGIEPSVDLETLDERIKIREMILKGQIQEAIALINSLHPELLDTNRYLYFHLQQQHLIELIRQRETEAALEFAQTQLAEQGEESRECLTEMERTLALLAFDSPEESPFGDLLHTMQRQKVWSEVNQAVLDYENRESTPKLAKLLKLLLWAQNELDQKKVKYPKMTDLSKGVIEEPK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2524-Ab Anti-GID8 monoclonal antibody
    Target Antigen GM-Tg-g-IP2524-Ag GID8 protein
    ORF Viral Vector pGMLP003466 Human GID8 Lentivirus plasmid
    ORF Viral Vector vGMLP003466 Human GID8 Lentivirus particle


    Target information

    Target ID GM-IP2524
    Target Name GID8
    Gene Group Identifier
    （Target Gene ID in Homo species)         		54994
    Gene ID 100051346 (Equus caballus), 101096971 (Felis catus), 296466 (Rattus norvegicus), 488056 (Canis lupus familiaris)
    505570 (Bos taurus), 54994 (Homo sapiens), 698189 (Macaca mulatta), 76425 (Mus musculus)
    Gene Symbols & Synonyms GID8,Gid8,Bwk1,TWA1,C24H20orf11,C13H20orf11,C20orf11,C10H20orf11,Twa1,2310003C23Rik,4833420G11Rik
    Target Alternative Names 2310003C23Rik,4833420G11Rik,Bwk1,C10H20orf11,C13H20orf11,C20orf11,C24H20orf11,GID8,Gid8,Glucose-induced degradation protein 8 homolog,TWA1,Twa1,Two hybrid-associated protein 1 with RanBPM (Twa1)
    Uniprot Accession Q32L52,Q9D7M1,Q9NWU2
    Additional SwissProt Accessions: Q32L52,Q9NWU2,Q9D7M1
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000011992, ENSCAFG00845018539, ENSBTAG00000001827, ENSG00000101193, ENSMMUG00000050053, ENSMUSG00000027573
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.