Human SLAMF6/CD352/KALI ORF/cDNA clone-Lentivirus plasmid (NM_052931.4)

Cat. No.: pGMLP005211
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SLAMF6/CD352/KALI Lentiviral expression plasmid for SLAMF6 lentivirus packaging, SLAMF6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to SLAMF6/NTB-A/CD352/SLAMF6/CD352 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $549
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005211
Gene Name SLAMF6
Accession Number NM_052931.4
Gene ID 114836
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 996 bp
Gene Alias CD352,KALI,KALIb,Ly108,NTB-A,NTBA,SF2000
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTGTGGCTGTTCCAATCGCTCCTGTTTGTCTTCTGCTTTGGCCCAGGGAATGTAGTTTCACAAAGCAGCTTAACCCCATTGATGGTGAACGGGATTCTGGGGGAGTCAGTAACTCTTCCCCTGGAGTTTCCTGCAGGAGAGAAGGTCAACTTCATCACTTGGCTTTTCAATGAAACATCTCTTGCCTTCATAGTACCCCATGAAACCAAAAGTCCAGAAATCCACGTGACTAATCCGAAACAGGGAAAGCGACTGAACTTCACCCAGTCCTACTCCCTGCAACTCAGCAACCTGAAGATGGAAGACACAGGCTCTTACAGAGCCCAGATATCCACAAAGACCTCTGCAAAGCTGTCCAGTTACACTCTGAGGATATTAAGACAACTGAGGAACATACAAGTTACCAATCACAGTCAGCTATTTCAGAATATGACCTGTGAGCTCCATCTGACTTGCTCTGTGGAGGATGCAGATGACAATGTCTCATTCAGATGGGAGGCCTTGGGAAACACACTTTCAAGTCAGCCAAACCTCACTGTCTCCTGGGACCCCAGGATTTCCAGTGAACAGGACTACACCTGCATAGCAGAGAATGCTGTCAGTAATTTATCCTTCTCTGTCTCTGCCCAGAAGCTTTGCGAAGATGTTAAAATTCAATATACAGATACCAAAATGATTCTGTTTATGGTTTCTGGGATATGCATAGTCTTCGGTTTCATCATACTGCTGTTACTTGTTTTGAGGAAAAGAAGAGATTCCCTATCTTTGTCTACTCAGCGAACACAGGGCCCCGAGTCCGCAAGGAACCTAGAGTATGTTTCAGTGTCTCCAACGAACAACACTGTGTATGCTTCAGTCACTCATTCAAACAGGGAAACAGAAATCTGGACACCTAGAGAAAATGATACTATCACAATTTACTCCACAATTAATCATTCCAAAGAGAGTAAACCCACTTTTTCCAGGGCAACTGCCCTTGACAATGTCGTGTAA
ORF Protein Sequence MLWLFQSLLFVFCFGPGNVVSQSSLTPLMVNGILGESVTLPLEFPAGEKVNFITWLFNETSLAFIVPHETKSPEIHVTNPKQGKRLNFTQSYSLQLSNLKMEDTGSYRAQISTKTSAKLSSYTLRILRQLRNIQVTNHSQLFQNMTCELHLTCSVEDADDNVSFRWEALGNTLSSQPNLTVSWDPRISSEQDYTCIAENAVSNLSFSVSAQKLCEDVKIQYTDTKMILFMVSGICIVFGFIILLLLVLRKRRDSLSLSTQRTQGPESARNLEYVSVSPTNNTVYASVTHSNRETEIWTPRENDTITIYSTINHSKESKPTFSRATALDNVV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T54460-Ab Anti-SLAF6/ SLAMF6/ CD352 monoclonal antibody
    Target Antigen GM-Tg-g-T54460-Ag SLAMF6 VLP (virus-like particle)
    ORF Viral Vector pGMLP000239 Human SLAMF6 Lentivirus plasmid
    ORF Viral Vector pGMLP005211 Human SLAMF6 Lentivirus plasmid
    ORF Viral Vector vGMLP000239 Human SLAMF6 Lentivirus particle
    ORF Viral Vector vGMLP005211 Human SLAMF6 Lentivirus particle


    Target information

    Target ID GM-T54460
    Target Name SLAMF6/NTB-A/CD352
    Gene Group Identifier
    （Target Gene ID in Homo species)         		114836
    Gene ID 100058672 (Equus caballus), 100684044 (Canis lupus familiaris), 101090327 (Felis catus), 114836 (Homo sapiens)
    30925 (Mus musculus), 498287 (Rattus norvegicus), 508183 (Bos taurus), 719728 (Macaca mulatta)
    Gene Symbols & Synonyms SLAMF6,Slamf6,KALI,NTBA,CD352,KALIb,Ly108,NTB-A,SF2000,KAL1,KAL1b,RGD1561848
    Target Alternative Names Activating NK receptor,CD352,KAL1,KAL1b,KALI,KALIb,Ly108,NK-T-B-antigen (NTB-A),NTB-A,NTBA,RGD1561848,SF2000,SLAM family member 6,SLAMF6,Slamf6
    Uniprot Accession Q96DU3,Q9ET39
    Additional SwissProt Accessions: Q96DU3,Q9ET39
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000021098, ENSG00000162739, ENSMUSG00000015314, ENSBTAG00000014368, ENSMMUG00000015601
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.