Human CRP/PTX1 ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_000567.2)

Cat. No.: vGMAAV000165

Pre-made Human CRP/PTX1 Adeno-associated virus particle for CRP in-vivo study, mechanism of action (MOA) research and CRP-associated gene therapy development.

At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.

Target products collection

Go to C-Reactive Protein/CRP/CRP/PTX1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name AAV serotype AAV Grade AAV quantity
vGMAAV000165 Human CRP Adeno-associate virus(AAV) particle AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF Pilot Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
Research Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAAV000165
Gene Name CRP
Accession Number NM_000567.2
Gene ID 1401
Species Human
Product Type Adeno-associate virus(AAV) particle (overexpression)
Insert Length 675 bp
Gene Alias PTX1
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGAAGCTGTTGTGTTTCTTGGTCTTGACCAGCCTCTCTCATGCTTTTGGCCAGACAGACATGTCGAGGAAGGCTTTTGTGTTTCCCAAAGAGTCGGATACTTCCTATGTATCCCTCAAAGCACCGTTAACGAAGCCTCTCAAAGCCTTCACTGTGTGCCTCCACTTCTACACGGAACTGTCCTCGACCCGTGGGTACAGTATTTTCTCGTATGCCACCAAGAGACAAGACAATGAGATTCTCATATTTTGGTCTAAGGATATAGGATACAGTTTTACAGTGGGTGGGTCTGAAATATTATTCGAGGTTCCTGAAGTCACAGTAGCTCCAGTACACATTTGTACAAGCTGGGAGTCCGCCTCAGGGATCGTGGAGTTCTGGGTAGATGGGAAGCCCAGGGTGAGGAAGAGTCTGAAGAAGGGATACACTGTGGGGGCAGAAGCAAGCATCATCTTGGGGCAGGAGCAGGATTCCTTCGGTGGGAACTTTGAAGGAAGCCAGTCCCTGGTGGGAGACATTGGAAATGTGAACATGTGGGACTTTGTGCTGTCACCAGATGAGATTAACACCATCTATCTTGGCGGGCCCTTCAGTCCTAATGTCCTGAACTGGCGGGCACTGAAGTATGAAGTGCAAGGCGAAGTGTTCACCAAACCCCAGCTGTGGCCCTGA
ORF Protein Sequence MEKLLCFLVLTSLSHAFGQTDMSRKAFVFPKESDTSYVSLKAPLTKPLKAFTVCLHFYTELSSTRGYSIFSYATKRQDNEILIFWSKDIGYSFTVGGSEILFEVPEVTVAPVHICTSWESASGIVEFWVDGKPRVRKSLKKGYTVGAEASIILGQEQDSFGGNFEGSQSLVGDIGNVNMWDFVLSPDEINTIYLGGPFSPNVLNWRALKYEVQGEVFTKPQLWP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0824-Ab Anti-CRP/ PTX1 functional antibody
    Target Antigen GM-Tg-g-SE0824-Ag CRP protein
    Cytokine cks-Tg-g-GM-SE0824 C-reactive protein, pentraxin-related (CRP) protein & antibody
    ORF Viral Vector pGMLV002473 Human CRP Lentivirus plasmid
    ORF Viral Vector pGMAAV000165 Human CRP Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000461 Human CRP Adenovirus plasmid
    ORF Viral Vector vGMLV002473 Human CRP Lentivirus particle
    ORF Viral Vector vGMAAV000165 Human CRP Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000461 Human CRP Adenovirus particle


    Target information

    Target ID GM-SE0824
    Target Name C-Reactive Protein/CRP
    Gene Group Identifier
    （Target Gene ID in Homo species)         		1401
    Gene ID 101093079 (Felis catus), 12944 (Mus musculus), 138915014 (Equus caballus), 1401 (Homo sapiens)
    25419 (Rattus norvegicus), 488629 (Canis lupus familiaris), 527553 (Bos taurus), 719454 (Macaca mulatta)
    Gene Symbols & Synonyms CRP,Crp,PTX1,Aa1249,Ac1262,Ab1-341,Ab2-196,Ac1-114,Ac2-069,Ba2-693
    Target Alternative Names Aa1249,Ab1-341,Ab2-196,Ac1-114,Ac1262,Ac2-069,Ba2-693,C-Reactive Protein,C-reactive protein,CRP,Crp,PTX1
    Uniprot Accession P02741,P14847,P48199
    Additional SwissProt Accessions: P14847,P02741,P48199
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Diagnostics Biomarker, Cytokine Target
    Disease cancer, Breast Cancer, cardiovascular disease, Pregnant state, pancreatic, renal, gastrointestinal, tissue damage, Acute coronary syndromes, Cardiovascular Diseases, cardiovascular events, cardiovascular outcome, coronary ischemic events, infections, Infectious disease: falciparum malaria, Infectious disease: AIDS, Infectious disease: ATL, Infectious disease: hepatitis, Infectious disease: herpes simplex, Infectious disease: syphilis, Infectious disease: TB, Inflammation, Inflammatory reactions, lymphoma, Mediastinal lympadenopathy, melanoma, myeloma, ovarian, Sepsis, neonatal infections, Non-small cell lung carcinoma
    Disease from KEGG
    Gene Ensembl ENSMUSG00000037942, ENSG00000132693, ENSCAFG00845030990, ENSMMUG00000008922
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.