Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human NTF3/HDNF/NGF-2 ORF/cDNA clone-Adenovirus particle (NM_001102654)
Cat. No.: vGMAD000046
Pre-made Human NTF3/HDNF/NGF-2 Adenovirus for NTF3 overexpression in-vitro and in-vivo. The NTF3 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified NTF3-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
Neurotrophin 3/NTF3/NTF3/HDNF products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAD000046 | Human NTF3 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAD000046 |
| Gene Name | NTF3 |
| Accession Number | NM_001102654 |
| Gene ID | 4908 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 813 bp |
| Gene Alias | HDNF,NGF-2,NGF2,NT-3,NT3 |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGTTACTTTTGCCACGATCTTACAGGTGAACAAGGTGATGTCCATCTTGTTTTATGTGATATTTCTCGCTTATCTCCGTGGCATCCAAGGTAACAACATGGATCAAAGGAGTTTGCCAGAAGACTCGCTCAATTCCCTCATTATTAAGCTGATCCAGGCAGATATTTTGAAAAACAAGCTCTCCAAGCAGATGGTGGACGTTAAGGAAAATTACCAGAGCACCCTGCCCAAAGCTGAGGCTCCCCGAGAGCCGGAGCGGGGAGGGCCCGCCAAGTCAGCATTCCAGCCGGTGATTGCAATGGACACCGAACTGCTGCGACAACAGAGACGCTACAACTCACCGCGGGTCCTGCTGAGCGACAGCACCCCCTTGGAGCCCCCGCCCTTGTATCTCATGGAGGATTACGTGGGCAGCCCCGTGGTGGCGAACAGAACATCACGGCGGAAACGGTACGCGGAGCATAAGAGTCACCGAGGGGAGTACTCGGTATGTGACAGTGAGAGTCTGTGGGTGACCGACAAGTCATCGGCCATCGACATTCGGGGACACCAGGTCACGGTGCTGGGGGAGATCAAAACGGGCAACTCTCCCGTCAAACAATATTTTTATGAAACGCGATGTAAGGAAGCCAGGCCGGTCAAAAACGGTTGCAGGGGTATTGATGATAAACACTGGAACTCTCAGTGCAAAACATCCCAAACCTACGTCCGAGCACTGACTTCAGAGAACAATAAACTCGTGGGCTGGCGGTGGATACGGATAGACACGTCCTGTGTGTGTGCCTTGTCGAGAAAAATCGGAAGAACATGA |
| ORF Protein Sequence | MVTFATILQVNKVMSILFYVIFLAYLRGIQGNNMDQRSLPEDSLNSLIIKLIQADILKNKLSKQMVDVKENYQSTLPKAEAPREPERGGPAKSAFQPVIAMDTELLRQQRRYNSPRVLLSDSTPLEPPPLYLMEDYVGSPVVANRTSRRKRYAEHKSHRGEYSVCDSESLWVTDKSSAIDIRGHQVTVLGEIKTGNSPVKQYFYETRCKEARPVKNGCRGIDDKHWNSQCKTSQTYVRALTSENNKLVGWRWIRIDTSCVCALSRKIGRT |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T32855-Ab | Anti-NTF3/ HDNF/ NGF-2 functional antibody |
| Target Antigen | GM-Tg-g-T32855-Ag | NTF3 protein |
| ORF Viral Vector | pGMLV002188 | Human NTF3 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000046 | Human NTF3 Adenovirus plasmid |
| ORF Viral Vector | pGMAP000383 | Human NTF3 Adenovirus plasmid |
| ORF Viral Vector | vGMLV002188 | Human NTF3 Lentivirus particle |
| ORF Viral Vector | vGMAD000046 | Human NTF3 Adenovirus particle |
| ORF Viral Vector | vGMAP000383 | Human NTF3 Adenovirus particle |
Target information
| Target ID | GM-T32855 |
| Target Name | Neurotrophin 3/NTF3 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
4908 |
| Gene ID |
100051839 (Equus caballus), 18205 (Mus musculus), 486731 (Canis lupus familiaris), 4908 (Homo sapiens) 493963 (Felis catus), 532393 (Bos taurus), 721988 (Macaca mulatta), 81737 (Rattus norvegicus) |
| Gene Symbols & Synonyms | NTF3,Ntf3,Nt3,HDNF,NGF-2,Ntf-3,NT3,NGF2,NT-3 |
| Target Alternative Names | HDNF,NGF-2,NGF2,NT-3,NT3,NTF3,Nerve growth factor 2 (NGF-2),Neurotrophic factor,Neurotrophin 3,Neurotrophin-3,Nt3,Ntf-3,Ntf3 |
| Uniprot Accession |
P18280,P20181,P20783,Q08DT3,Q9TST2
Additional SwissProt Accessions: P20181,P20783,Q9TST2,Q08DT3,P18280 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target |
| Disease | Schizophrenia |
| Disease from KEGG | MAPK signaling pathway, Ras signaling pathway, PI3K-Akt signaling pathway, Neurotrophin signaling pathway |
| Gene Ensembl | ENSECAG00000024611, ENSMUSG00000049107, ENSCAFG00845030324, ENSG00000185652, ENSBTAG00000010223, ENSMMUG00000014646 |
| Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.