Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human IFNA1/IFL/IFN ORF/cDNA clone-Adenovirus particle (NM_024013.2)
Cat. No.: vGMAD000576
Pre-made Human IFNA1/IFL/IFN Adenovirus for IFNA1 overexpression in-vitro and in-vivo. The IFNA1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IFNA1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
IFNA13/Interferon alpha 1/IFNA1/IFNA1/IFL products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAD000576 | Human IFNA1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAD000576 |
| Gene Name | IFNA1 |
| Accession Number | NM_024013.2 |
| Gene ID | 3439 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 570 bp |
| Gene Alias | IFL,IFN,IFN-ALPHA,IFN-alphaD,IFNA13,IFNA@ |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCTCGCCCTTTGCTTTACTGATGGTCCTGGTGGTGCTCAGCTGCAAGTCAAGCTGCTCTCTGGGCTGTGATCTCCCTGAGACCCACAGCCTGGATAACAGGAGGACCTTGATGCTCCTGGCACAAATGAGCAGAATCTCTCCTTCCTCCTGTCTGATGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGATGGCAACCAGTTCCAGAAGGCTCCAGCCATCTCTGTCCTCCATGAGCTGATCCAGCAGATCTTCAACCTCTTTACCACAAAAGATTCATCTGCTGCTTGGGATGAGGACCTCCTAGACAAATTCTGCACCGAACTCTACCAGCAGCTGAATGACTTGGAAGCCTGTGTGATGCAGGAGGAGAGGGTGGGAGAAACTCCCCTGATGAATGCGGACTCCATCTTGGCTGTGAAGAAATACTTCCGAAGAATCACTCTCTATCTGACAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCCTCTCTTTATCAACAAACTTGCAAGAAAGATTAAGGAGGAAGGAATAA |
| ORF Protein Sequence | MASPFALLMVLVVLSCKSSCSLGCDLPETHSLDNRRTLMLLAQMSRISPSSCLMDRHDFGFPQEEFDGNQFQKAPAISVLHELIQQIFNLFTTKDSSAAWDEDLLDKFCTELYQQLNDLEACVMQEERVGETPLMNADSILAVKKYFRRITLYLTEKKYSPCAWEVVRAEIMRSLSLSTNLQERLRRKE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE0977-Ab | Anti-IFNA1/ IFNA13 functional antibody |
| Target Antigen | GM-Tg-g-SE0977-Ag | IFNA13 protein |
| Cytokine | cks-Tg-g-GM-SE0977 | interferon, alpha 13 (IFNA13) protein & antibody |
| ORF Viral Vector | pGMLP000155 | Human IFNA13 Lentivirus plasmid |
| ORF Viral Vector | pGMLP000551 | Human IFNA1 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000576 | Human IFNA1 Adenovirus plasmid |
| ORF Viral Vector | pGMAP000481 | Human IFNA1 Adenovirus plasmid |
| ORF Viral Vector | vGMLP000155 | Human IFNA13 Lentivirus particle |
| ORF Viral Vector | vGMLP000551 | Human IFNA1 Lentivirus particle |
| ORF Viral Vector | vGMAD000576 | Human IFNA1 Adenovirus particle |
| ORF Viral Vector | vGMAP000481 | Human IFNA1 Adenovirus particle |
Target information
| Target ID | GM-SE0977 |
| Target Name | IFNA13/Interferon alpha 1/IFNA1 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
3447 |
| Gene ID | |
| Gene Symbols & Synonyms | |
| Target Alternative Names | IFN-alpha-1/13,IFNA1,IFNA13,Interferon alpha 1,Interferon alpha-1/13,Interferon alpha-D (LeIF D) |
| Uniprot Accession | |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Cytokine Target |
| Disease | |
| Disease from KEGG | Cytokine-cytokine receptor interaction, PI3K-Akt signaling pathway, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, JAK-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Alcoholic liver disease, Tuberculosis, Hepatitis C, Hepatitis B, Measles, Human cytomegalovirus infection, Influenza A, Human papillomavirus infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Autoimmune thyroid disease, Lipid and atherosclerosis |
| Gene Ensembl | |
| Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.