Human FCER1A/FCE1A/FcERI ORF/cDNA clone-Lentivirus plasmid (NM_002001)

Cat. No.: pGMLP000440
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FCER1A/FCE1A/FcERI Lentiviral expression plasmid for FCER1A lentivirus packaging, FCER1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to Fc Epsilon RI Alpha/FCER1A/FCER1A/FCE1A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $493.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000440
Gene Name FCER1A
Accession Number NM_002001
Gene ID 2205
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 774 bp
Gene Alias FCE1A,FcERI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTCCTGCCATGGAATCCCCTACTCTACTGTGTGTAGCCTTACTGTTCTTCGCTCCAGATGGCGTGTTAGCAGTCCCTCAGAAACCTAAGGTCTCCTTGAACCCTCCATGGAATAGAATATTTAAAGGAGAGAATGTGACTCTTACATGTAATGGGAACAATTTCTTTGAAGTCAGTTCCACCAAATGGTTCCACAATGGCAGCCTTTCAGAAGAGACAAATTCAAGTTTGAATATTGTGAATGCCAAATTTGAAGACAGTGGAGAATACAAATGTCAGCACCAACAAGTTAATGAGAGTGAACCTGTGTACCTGGAAGTCTTCAGTGACTGGCTGCTCCTTCAGGCCTCTGCTGAGGTGGTGATGGAGGGCCAGCCCCTCTTCCTCAGGTGCCATGGTTGGAGGAACTGGGATGTGTACAAGGTGATCTATTATAAGGATGGTGAAGCTCTCAAGTACTGGTATGAGAACCACAACATCTCCATTACAAATGCCACAGTTGAAGACAGTGGAACCTACTACTGTACGGGCAAAGTGTGGCAGCTGGACTATGAGTCTGAGCCCCTCAACATTACTGTAATAAAAGCTCCGCGTGAGAAGTACTGGCTACAATTTTTTATCCCATTGTTGGTGGTGATTCTGTTTGCTGTGGACACAGGATTATTTATCTCAACTCAGCAGCAGGTCACATTTCTCTTGAAGATTAAGAGAACCAGGAAAGGCTTCAGACTTCTGAACCCACATCCTAAGCCAAACCCCAAAAACAACTGA
ORF Protein Sequence MAPAMESPTLLCVALLFFAPDGVLAVPQKPKVSLNPPWNRIFKGENVTLTCNGNNFFEVSSTKWFHNGSLSEETNSSLNIVNAKFEDSGEYKCQHQQVNESEPVYLEVFSDWLLLQASAEVVMEGQPLFLRCHGWRNWDVYKVIYYKDGEALKYWYENHNISITNATVEDSGTYYCTGKVWQLDYESEPLNITVIKAPREKYWLQFFIPLLVVILFAVDTGLFISTQQQVTFLLKIKRTRKGFRLLNPHPKPNPKNN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0438-Ab Anti-FCERA/ FCER1A/ FCE1A monoclonal antibody
    Target Antigen GM-Tg-g-MP0438-Ag FCER1A VLP (virus-like particle)
    ORF Viral Vector pGMLP000440 Human FCER1A Lentivirus plasmid
    ORF Viral Vector vGMLP000440 Human FCER1A Lentivirus particle


    Target information

    Target ID GM-MP0438
    Target Name Fc Epsilon RI Alpha/FCER1A
    Gene Group Identifier
    （Target Gene ID in Homo species)         		2205
    Gene ID 100057308 (Equus caballus), 101094323 (Felis catus), 14125 (Mus musculus), 2205 (Homo sapiens)
    25047 (Rattus norvegicus), 478970 (Canis lupus familiaris), 506783 (Bos taurus), 719324 (Macaca mulatta)
    Gene Symbols & Synonyms FCER1A,Fcer1a,FcERI,Fce1a,Fcr-5,fcepsilonri,FCE1A,FCERIA,Iger01,RATIGER01
    Target Alternative Names FCE1A,FCER1A,FCERIA,Fc Epsilon RI Alpha,Fc-epsilon RI-alpha (FcERI),FcERI,Fce1a,Fcer1a,Fcr-5,High affinity immunoglobulin epsilon receptor subunit alpha,IgE Fc receptor subunit alpha,Iger01,RATIGER01,fcepsilonri
    Uniprot Accession P12319,P12371,P20489
    Additional SwissProt Accessions: P20489,P12319,P12371
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease Prostate Cancer
    Disease from KEGG Sphingolipid signaling pathway, Phospholipase D signaling pathway, Fc epsilon RI signaling pathway, Asthma
    Gene Ensembl ENSECAG00000008710, ENSMUSG00000005339, ENSG00000179639, ENSCAFG00845015284, ENSBTAG00000012887, ENSMMUG00000013428
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.